• Je něco špatně v tomto záznamu ?

Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene

S. Legartová, P. Fagherazzi, P. Goswami, V. Brazda, G. Lochmanová, I. Koutná, E. Bártová

. 2023 ; 204 (-) : 154-168. [pub] 20220924

Jazyk angličtina Země Francie

Typ dokumentu časopisecké články

Perzistentní odkaz   https://www.medvik.cz/link/bmc23004809

An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.

Citace poskytuje Crossref.org

000      
00000naa a2200000 a 4500
001      
bmc23004809
003      
CZ-PrNML
005      
20250617082544.0
007      
ta
008      
230418e20220924fr f 000 0|eng||
009      
AR
024    7_
$a 10.1016/j.biochi.2022.09.013 $2 doi
035    __
$a (PubMed)36167255
040    __
$a ABA008 $b cze $d ABA008 $e AACR2
041    0_
$a eng
044    __
$a fr
100    1_
$a Legartová, Soňa $u Department of Cell Biology and Epigenetics, Institute of Biophysics, Academy of Sciences of the Czech Republic, Brno, Czech Republic. Electronic address: legartova@ibp.cz
245    10
$a Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene / $c S. Legartová, P. Fagherazzi, P. Goswami, V. Brazda, G. Lochmanová, I. Koutná, E. Bártová
520    9_
$a An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.
650    12
$a nádorový supresorový protein p53 $x genetika $x metabolismus $7 D016159
650    12
$a geny p53 $7 D016158
650    _2
$a fosforylace $7 D010766
650    _2
$a poškození DNA $7 D004249
650    _2
$a oprava DNA $7 D004260
650    _2
$a DNA $x metabolismus $7 D004247
655    _2
$a časopisecké články $7 D016428
700    1_
$a Fagherazzi, Paolo $u Department of Cell Biology and Epigenetics, Institute of Biophysics, Academy of Sciences of the Czech Republic, Brno, Czech Republic; Department of Experimental Biology, Faculty of Science, Masaryk University, Brno, Czech Republic. Electronic address: fagher@ibp.cz
700    1_
$a Goswami, Pratik $u Department of Biophysical Chemistry and Molecular Oncology, Institute of Biophysics, Academy of Sciences of the Czech Republic, Brno, Czech Republic; National Centre for Biomolecular Research, Faculty of Science, Masaryk University, Brno, Czech Republic. Electronic address: pratikgoswami@ibp.cz
700    1_
$a Brazda, Vaclav $u Department of Biophysical Chemistry and Molecular Oncology, Institute of Biophysics, Academy of Sciences of the Czech Republic, Brno, Czech Republic. Electronic address: vaclav@ibp.cz
700    1_
$a Lochmanová, Gabriela, $d 1979- $u Central European Institute of Technology, Masaryk University, Brno, Czech Republic; National Centre for Biomolecular Research, Faculty of Science, Masaryk University, Brno, Czech Republic. Electronic address: gabriela.lochmanova@ceitec.muni.cz $7 mub20201084748
700    1_
$a Koutná, Irena $u The International Clinical Research Center of St. Anne's University Hospital in Brno (FNUSA-ICRC), Pekařská 53, 656 91, Brno, Czech Republic
700    1_
$a Bártová, Eva, $u Department of Cell Biology and Epigenetics, Institute of Biophysics, Academy of Sciences of the Czech Republic, Brno, Czech Republic. Electronic address: bartova@ibp.cz $d 1968- $7 xx0028314
773    0_
$w MED00009325 $t Biochimie $x 1638-6183 $g Roč. 204 (20220924), s. 154-168
856    41
$u https://pubmed.ncbi.nlm.nih.gov/36167255 $y Pubmed
910    __
$a ABA008 $b sig $c sign $y p $z 0
990    __
$a 20230418 $b ABA008
991    __
$a 20250617082536 $b ABA008
999    __
$a ok $b bmc $g 1925101 $s 1191018
BAS    __
$a 3
BAS    __
$a PreBMC-MEDLINE
BMC    __
$a 2023 $b 204 $c - $d 154-168 $e 20220924 $i 1638-6183 $m Biochimie $n Biochimie $x MED00009325
LZP    __
$a Pubmed-20230418

Najít záznam

Citační ukazatele

Nahrávání dat ...

Možnosti archivace

Nahrávání dat ...