Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.

Central European Institute of Technology Masaryk University Kamenice 753 3 625 00 Brno Czech Republic

Institute of Biophysics of the Czech Academy of Sciences Královopolská 135 612 65 Brno Czech Republic

Zobrazit více v PubMed

N. G. Dolinnaya, A. M. Ogloblina, M. G. Yakubovskaya, Biochemistry 2016, 81, 1602-1649.

G. Biffi, D. Tannahill, J. McCafferty, S. Balasubramanian, Nat. Chem. 2013, 5, 182-186;

M. Di Antonio, A. Ponjavic, A. Radzevičius, R. T. Ranasinghe, M. Catalano, X. Zhang, J. Shen, L.-M. Needham, S. F. Lee, D. Klenerman, S. Balasubramanian, Nat. Chem. 2020, 12, 832-837;

G. F. Salgado, C. Cazenave, A. Kerkour, J. L. Mergny, Chem. Sci. 2015, 6, 3314-3320;

C. Ribeyre, J. Lopes, J. B. Boule, A. Piazza, A. Guedin, V. A. Zakian, J. L. Mergny, A. Nicolas, PLoS Genet. 2009, 5, 14.

R. Hänsel-Hertsch, M. Di Antonio, S. Balasubramanian, Nat. Rev. Mol. Cell Biol. 2017, 18, 279-284;

D. Rhodes, H. J. Lipps, Nucleic Acids Res. 2015, 43, 8627-8637.

N. Maizels, EMBO Rep. 2015, 16, 910-922;

R. Simone, P. Fratta, S. Neidle, G. N. Parkinson, A. M. Isaacs, FEBS Lett. 2015, 589, 1653-1668.

S. Neidle, M. A. Read, Biopolymers 2000, 56, 195-208;

C.-R. Graziella, Z. Nadia, F. Marco, Curr. Pharm. Des. 2016, 22, 6612-6624.

J. L. Mergny, D. Sen, Chem. Rev. 2019, 119, 6290-6325.

J. L. Mergny, A. De Cian, A. Ghelab, B. Sacca, L. Lacroix, Nucleic Acids Res. 2005, 33, 81-94.

S. Neidle, S. Balasubramanian, Quadruplex Nucleic Acids, Royal Society of Chemistry, Cambridge, 2006, p. 1-301.

G. N. Parkinson, M. P. H. Lee, S. Neidle, Nature 2002, 417, 876-880.

Y. Y. Geng, C. D. Liu, B. Zhou, Q. X. Cai, H. T. Miao, X. Shi, N. N. Xu, Y. Y. You, C. P. Fung, R. U. Din, G. Zhu, Nucleic Acids Res. 2019, 47, 5395-5404;

K. W. Lim, V. C. M. Ng, N. Martin-Pintado, B. Heddi, A. T. Phan, Nucleic Acids Res. 2013, 41, 10556-10562.

A. T. Phan, K. N. Luu, D. J. Patel, Nucleic Acids Res. 2006, 34, 5715-5719;

K. N. Luu, A. T. Phan, V. V. Kuryavyi, L. Lacroix, D. J. Patel, J. Am. Chem. Soc. 2006, 128, 9963-9970;

A. Ambrus, D. Chen, J. Dai, T. Bialis, R. A. Jones, D. Yang, Nucleic Acids Res. 2006, 34, 2723-2735;

D. Renciuk, I. Kejnovska, P. Skolakova, K. Bednarova, J. Motlova, M. Vorlickova, Nucleic Acids Res. 2009, 37, 6625-6634.

B. Sacca, L. Lacroix, J. L. Mergny, Nucleic Acids Res. 2005, 33, 1182-1192;

M. Babinsky, R. Fiala, I. Kejnovska, K. Bednarova, R. Marek, J. Sagi, V. Sklenar, M. Vorlickova, Nucleic Acids Res. 2014, 42, 14031-14041;

I. Kejnovska, K. Bednarova, D. Renciuk, Z. Dvorakova, P. Skolakova, L. Trantirek, R. Fiala, M. Vorlickova, J. Sagi, Nucleic Acids Res. 2017, 45, 4294-4305.

P. Schultze, R. F. Macaya, J. Feigon, J. Mol. Biol. 1994, 235, 1532-1547;

K. W. Lim, S. Amrane, S. Bouaziz, W. Xu, Y. Mu, D. J. Patel, K. N. Luu, A. T. Phan, J. Am. Chem. Soc. 2009, 131, 4301-4309;

M. L. Živković, J. Rozman, J. Plavec, Angew. Chem. Int. Ed. 2018, 57, 15395-15399;

Angew. Chem. 2018, 130, 15621-15625;

A. Kotar, R. Rigo, C. Sissi, J. Plavec, Nucleic Acids Res. 2019, 47, 2641-2653.

M. Y. Qin, Z. X. Chen, Q. C. Luo, Y. Wen, N. X. Zhang, H. L. Jiang, H. Y. Yang, J. Phys. Chem. B 2015, 119, 3706-3713.

W. J. Chung, B. Heddi, E. Schmitt, K. W. Lim, Y. Mechulam, A. T. Phan, R. M. Abu-Ghazalah, Proc. Natl. Acad. Sci. USA 2015, 112, 2729-2733;

N. Q. Do, W. J. Chung, T. Hong, A. Truong, B. Heddi, A. T. Phan, Nucleic Acids Res. 2017, 45, 7487-7493;

A. Maity, F. R. Winnerdy, W. D. Chang, G. Chen, A. T. Phan, Nucleic Acids Res. 2020, 48, 3315-3327;

B. Bakalar, B. Heddi, E. Schmitt, Y. Mechulam, A. T. Phan, Angew. Chem. Int. Ed. 2019, 58, 2331-2335;

Angew. Chem. 2019, 131, 2353-2357.

F. R. Winnerdy, B. Bakalar, A. Maity, J. J. Vandana, Y. Mechulam, E. Schmitt, A. T. Phan, Nucleic Acids Res. 2019, 47, 8272-8281.

B. Heddi, N. Martin-Pintado, Z. Serimbetov, T. M. A. Kari, A. T. Phan, Nucleic Acids Res. 2016, 44, 910-916.

K. Bednarova, I. Kejnovska, M. Vorlickova, D. Renciuk, Chem. Eur. J. 2019, 25, 13422-13428.

K. Bednarova, M. Vorlíčková, D. Renčiuk, Int. J. Mol. Sci. 2020, 21, 6123-6137.

M. Vorlickova, I. Kejnovska, J. Sagi, D. Renciuk, K. Bednarova, J. Motlova, J. Kypr, Methods 2012, 57, 64-75.

I. Kejnovska, M. Vorlickova, M. Brazdova, J. Sagi, Biopolymers 2014, 101, 428-438.

R. Rocca, F. Palazzesi, J. Amato, G. Costa, F. Ortuso, B. Pagano, A. Randazzo, E. Novellino, S. Alcaro, F. Moraca, A. Artese, Sci. Rep. 2020, 10, 3176;

P. Stadlbauer, M. Krepl, T. E. Cheatham, J. Koca, J. Sponer, Nucleic Acids Res. 2013, 41, 7128-7143;

R. Stefl, T. E. Cheatham, N. Spackova, E. Fadrna, I. Berger, J. Koca, J. Sponer, Biophys. J. 2003, 85, 1787-1804.

M. Trajkovski, M. Webba da Silva, J. Plavec, J. Am. Chem. Soc. 2012, 134, 4132-4141.

Y. Krishnan-Ghosh, D. S. Liu, S. Balasubramanian, J. Am. Chem. Soc. 2004, 126, 11009-11016.

S. Haider, G. N. Parkinson, S. Neidle, J. Mol. Biol. 2002, 320, 189-200;

P. Hazel, G. N. Parkinson, S. Neidle, J. Am. Chem. Soc. 2006, 128, 5480-5487.

J. Sponer, G. Bussi, P. Stadlbauer, P. Kührová, P. Banáš, B. Islam, S. Haider, S. Neidle, M. Otyepka, Biochim. Biophys. Acta Gen. Subj. 2017, 1861, 1246-1263.

M. Kogut, C. Kleist, J. Czub, PLoS Comput. Biol. 2019, 15, e1007383;

C. J. Lech, B. Heddi, A. T. Phan, Nucleic Acids Res. 2013, 41, 2034-2046.

K. Usdin, Nucleic Acids Res. 1998, 26, 4078-4085;

M. Fry, L. A. Loeb, J. Biol. Chem. 1999, 274, 12797-12802.

B. Islam, P. Stadlbauer, M. Vorlickova, J. L. Mergny, M. Otyepka, J. Sponer, J. Chem. Theory Comput. 2020, 16, 3447-3463.

I. Kejnovska, D. Renciuk, J. Palacky, M. Vorlickova in CD Study of the G-Quadruplex Conformation, Vol. 2035 (Eds.: D. Yang, C. Lin), Humana, Totowa, 2019, pp. 25-44.

J. L. Mergny, A. T. Phan, L. Lacroix, FEBS Lett. 1998, 435, 74-78.

J. X. Dai, M. Carver, C. Punchihewa, R. A. Jones, D. Z. Yang, Nucleic Acids Res. 2007, 35, 4927-4940.

Y. Wang, D. J. Patel, Structure 1993, 1, 263-282.

F. Fogolari, H. Haridas, A. Corazza, P. Viglino, D. Cora, M. Caselle, G. Esposito, L. E. Xodo, BMC Struct. Biol. 2009, 9, 20.

H. J. C. Berendsen, J. R. Grigera, T. P. Straatsma, J. Phys. Chem. 1987, 91, 6269-6271.

I. S. Joung, T. E. Cheatham, J. Phys. Chem. B 2008, 112, 9020-9041.

N. Guex, M. C. Peitsch, Electrophoresis 1997, 18, 2714-2723.

D. A. Case, I. Y. Ben-Shalom, S. R. Brozell, D. S. Cerutti, T. E. Cheatham III, V. W. D. Cruzeiro, T. A. Darden, R. E. Duke, D. Ghoreishi, M. K. Gilson, H. Gohlke, A. W. Goetz, D. Greene, R. Harris, N. Homeyer, Y. Huang, S. Izadi, A. Kovalenko, T. Kurtzman, T. S. Lee, S. LeGrand, P. Li, C. Lin, J. Liu, T. Luchko, R. Luo, D. J. Mermelstein, K. M. Merz, Y. Miao, G. Monard, C. Nguyen, H. Nguyen, I. Omelyan, A. Onufriev, F. Pan, R. Qi, D. R. Roe, A. Roitberg, C. Sagui, S. Schott-Verdugo, J. Shen, C. L. Simmerling, J. Smith, R. Salomon-Ferrer, J. Swails, R. C. Walker, J. Wang, H. Wei, R. M. Wolf, X. Wu, L. Xiao, D. M. York, P. A. Kollman, AMBER 2018, University of California, San Francisco, 2018.

M. Krepl, M. Zgarbova, P. Stadlbauer, M. Otyepka, P. Banas, J. Koca, T. E. Cheatham, P. Jurecka, J. Sponer, J. Chem. Theory Comput. 2012, 8, 2506-2520.

A. Perez, I. Marchan, D. Svozil, J. Sponer, T. E. Cheatham, C. A. Laughton, M. Orozco, Biophys. J. 2007, 92, 3817-3829;

M. Zgarbova, F. J. Luque, J. Sponer, T. E. Cheatham, M. Otyepka, P. Jurecka, J. Chem. Theory Comput. 2013, 9, 2339-2354;

M. Zgarbova, J. Sponer, M. Otyepka, T. E. Cheatham, R. Galindo-Murillo, P. Jurecka, J. Chem. Theory Comput. 2015, 11, 5723-5736.

C. I. Bayly, K. M. Merz, Jr., D. M. Ferguson, W. D. Cornell, T. Fox, J. W. Caldwell, P. A. Kollman, P. Cieplak, I. R. Gould, D. C. Spellmeyer, J. Am. Chem. Soc. 1995, 117, 5179-5197.

P. Kuhrova, V. Mlynsky, M. Zgarbova, M. Krepl, G. Bussi, R. B. Best, M. Otyepka, J. Sponer, P. Banas, J. Chem. Theory Comput. 2019, 15, 3288-3305.

H. J. C. Berendsen, J. P. M. Postma, W. F. Vangunsteren, A. Dinola, J. R. Haak, J. Chem. Phys. 1984, 81, 3684-3690.

J. P. Ryckaert, G. Ciccotti, H. J. C. Berendsen, J. Comput. Phys. 1977, 23, 327-341.

S. Miyamoto, P. A. Kollman, J. Comput. Chem. 1992, 13, 952-962.

C. W. Hopkins, S. Le Grand, R. C. Walker, A. E. Roitberg, J. Chem. Theory Comput. 2015, 11, 1864-1874.

U. Essmann, L. Perera, M. L. Berkowitz, T. Darden, H. Lee, L. G. Pedersen, J. Chem. Phys. 1995, 103, 8577-8593.

R. Salomon-Ferrer, A. W. Gotz, D. Poole, S. Le Grand, R. C. Walker, J. Chem. Theory Comput. 2013, 9, 3878-3888.

NMR Screen Reveals the Diverse Structural Landscape of a G-Quadruplex Library

RNA G-quadruplex formation in biologically important transcribed regions: can two-tetrad intramolecular RNA quadruplexes be formed?

Variation in G-quadruplex sequence and topology differentially impacts human DNA polymerase fidelity

Guanine quadruplexes in the RNA genome of the tick-borne encephalitis virus: their role as a new antiviral target and in virus biology