The p53 protein is a key tumor suppressor and the most commonly mutated and down-regulated protein in human tumors. It functions mainly through interaction with DNA, and p53 acts as a transcription factor that recognizes the so-called p53 target sites on the promoters of various genes. P53 has been shown to exist as many isoforms, including three C-terminal isoforms that are produced by alternative splicing. Because the C-terminal domain is responsible for sequence-nonspecific binding and regulation of p53 binding, we have analyzed DNA recognition by these C-terminal isoforms. Using atomic force microscopy, we show for the first time that all C-terminal isoforms recognize superhelical DNA. It is particularly noteworthy that a sequence-specific p53 consensus binding site is bound by p53α and β isoforms with similar affinities, whilst p53α shows higher binding to a quadruplex sequence than both p53β and p53γ, and p53γ loses preferential binding to both the consensus binding sequence and the quadruplex-forming sequence. These results show the important role of the variable p53 C-terminal amino acid sequences for DNA recognition.
An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.
SARS-CoV-2 is an intensively investigated virus from the order Nidovirales (Coronaviridae family) that causes COVID-19 disease in humans. Through enormous scientific effort, thousands of viral strains have been sequenced to date, thereby creating a strong background for deep bioinformatics studies of the SARS-CoV-2 genome. In this study, we inspected high-frequency mutations of SARS-CoV-2 and carried out systematic analyses of their overlay with inverted repeat (IR) loci and CpG islands. The main conclusion of our study is that SARS-CoV-2 hot-spot mutations are significantly enriched within both IRs and CpG island loci. This points to their role in genomic instability and may predict further mutational drive of the SARS-CoV-2 genome. Moreover, CpG islands are strongly enriched upstream from viral ORFs and thus could play important roles in transcription and the viral life cycle. We hypothesize that hypermethylation of these loci will decrease the transcription of viral ORFs and could therefore limit the progression of the disease.
- MeSH
- COVID-19 virologie MeSH
- CpG ostrůvky * MeSH
- genom virový MeSH
- lidé MeSH
- metylace DNA MeSH
- mutace * MeSH
- SARS-CoV-2 genetika MeSH
- vazba proteinů MeSH
- Check Tag
- lidé MeSH
- Publikační typ
- časopisecké články MeSH
- práce podpořená grantem MeSH
The importance of DNA structure in the regulation of basic cellular processes is an emerging field of research. Among local non-B DNA structures, inverted repeat (IR) sequences that form cruciforms and G-rich sequences that form G-quadruplexes (G4) are found in all prokaryotic and eukaryotic organisms and are targets for regulatory proteins. We analyzed IRs and G4 sequences in the genome of the most important biotechnology microorganism, S. cerevisiae. IR and G4-prone sequences are enriched in specific genomic locations and differ markedly between mitochondrial and nuclear DNA. While G4s are overrepresented in telomeres and regions surrounding tRNAs, IRs are most enriched in centromeres, rDNA, replication origins and surrounding tRNAs. Mitochondrial DNA is enriched in both IR and G4-prone sequences relative to the nuclear genome. This extensive analysis of local DNA structures adds to the emerging picture of their importance in genome maintenance, DNA replication and transcription of subsets of genes.
The role of local DNA structures in the regulation of basic cellular processes is an emerging field of research. Amongst local non-B DNA structures, the significance of G-quadruplexes was demonstrated in the last decade, and their presence and functional relevance has been demonstrated in many genomes, including humans. In this study, we analyzed the presence and locations of G-quadruplex-forming sequences by G4Hunter in all complete bacterial genomes available in the NCBI database. G-quadruplex-forming sequences were identified in all species, however the frequency differed significantly across evolutionary groups. The highest frequency of G-quadruplex forming sequences was detected in the subgroup Deinococcus-Thermus, and the lowest frequency in Thermotogae. G-quadruplex forming sequences are non-randomly distributed and are favored in various evolutionary groups. G-quadruplex-forming sequences are enriched in ncRNA segments followed by mRNAs. Analyses of surrounding sequences showed G-quadruplex-forming sequences around tRNA and regulatory sequences. These data point to the unique and non-random localization of G-quadruplex-forming sequences in bacterial genomes.
- MeSH
- Bacteria genetika MeSH
- DNA bakterií chemie MeSH
- fylogeneze MeSH
- G-kvadruplexy * MeSH
- genom bakteriální MeSH
- konformace nukleové kyseliny MeSH
- lidé MeSH
- Check Tag
- lidé MeSH
- Publikační typ
- časopisecké články MeSH
