Transient melting of the duplex-DNA (B-DNA) during DNA transactions allows repeated sequences to fold into non-B-DNA structures, including DNA junctions and G-quadruplexes. These noncanonical structures can act as impediments to DNA polymerase progression along the duplex, thereby triggering DNA damage and ultimately jeopardizing genomic stability. Their stabilization by ad hoc ligands is currently being explored as a putative anticancer strategy since it might represent an efficient way to inflict toxic DNA damage specifically to rapidly dividing cancer cells. The relevance of this strategy is only emerging for three-way DNA junctions (TWJs) and, to date, no molecule has been recognized as a reference TWJ ligand, featuring both high affinity and selectivity. Herein, we characterize such reference ligands through a combination of in vitro techniques comprising affinity and selectivity assays (competitive FRET-melting and TWJ Screen assays), functional tests (qPCR and Taq stop assays) and structural analyses (molecular dynamics and NMR investigations). We identify novel azacryptands TrisNP-amphi and TrisNP-ana as the most promising ligands, interacting with TWJs with high affinity and selectivity. These ligands represent new molecular tools to investigate the cellular roles of TWJs and explore how they can be exploited in innovative anticancer therapies.
- Klíčová slova
- DNA junctions, NMR, in vitro assays, ligands, molecular dynamics,
- Publikační typ
- časopisecké články MeSH
I-Motifs (iM) are non-canonical DNA structures potentially forming in the accessible, single-stranded, cytosine-rich genomic regions with regulatory roles. Chromatin, protein interactions, and intracellular properties seem to govern iM formation at sites with i-motif formation propensity (iMFPS) in human cells, yet their specific contributions remain unclear. Using in-cell NMR with oligonucleotide iMFPS models, we monitor iM-associated structural equilibria in asynchronous and cell cycle-synchronized HeLa cells at 37 °C. Our findings show that iMFPS displaying pHT < 7 under reference in vitro conditions occur predominantly in unfolded states in cells, while those with pHT > 7 appear as a mix of folded and unfolded states depending on the cell cycle phase. Comparing these results with previous data obtained using an iM-specific antibody (iMab) reveals that cell cycle-dependent iM formation has a dual origin, and iM formation concerns only a tiny fraction (possibly 1%) of genomic sites with iM formation propensity. We propose a comprehensive model aligning observations from iMab and in-cell NMR and enabling the identification of iMFPS capable of adopting iM structures under physiological conditions in living human cells. Our results suggest that many iMFPS may have biological roles linked to their unfolded states.
- MeSH
- azidy * MeSH
- benzazepiny * MeSH
- DNA MeSH
- HeLa buňky MeSH
- lidé MeSH
- magnetická rezonanční tomografie * MeSH
- protilátky MeSH
- Check Tag
- lidé MeSH
- Publikační typ
- časopisecké články MeSH
- Názvy látek
- 7-iodo-8-hydroxy-3-methyl-1-(4-azidophenyl)-2,3,4,5-tetrahydro-1H-3-benzazepine MeSH Prohlížeč
- azidy * MeSH
- benzazepiny * MeSH
- DNA MeSH
- protilátky MeSH
DNA quadruplex structures provide an additional layer of regulatory control in genome maintenance and gene expression and are widely used in nanotechnology. We report the discovery of an unprecedented tetrastranded structure formed from a native G-rich DNA sequence originating from the telomeric region of Caenorhabditis elegans. The structure is defined by multiple properties that distinguish it from all other known DNA quadruplexes. Most notably, the formation of a stable so-called KNa-quadruplex (KNaQ) requires concurrent coordination of K+ and Na+ ions at two distinct binding sites. This structure provides novel insight into G-rich DNA folding under ionic conditions relevant to eukaryotic cell physiology and the structural evolution of telomeric DNA. It highlights the differences between the structural organization of human and nematode telomeric DNA, which should be considered when using C. elegans as a model in telomere biology, particularly in drug screening applications. Additionally, the absence/presence of KNaQ motifs in the host/parasite introduces an intriguing possibility of exploiting the KNaQ fold as a plausible antiparasitic drug target. The structure's unique shape and ion dependency and the possibility of controlling its folding by using low-molecular-weight ligands can be used for the design or discovery of novel recognition DNA elements and sensors.
- Klíčová slova
- DNA, NMR spectroscopy, quadruplex, telomere, unique cation dependency,
- MeSH
- Caenorhabditis elegans genetika MeSH
- DNA chemie MeSH
- G-kvadruplexy * MeSH
- kationty MeSH
- lidé MeSH
- sekvence nukleotidů MeSH
- telomery genetika MeSH
- zvířata MeSH
- Check Tag
- lidé MeSH
- zvířata MeSH
- Publikační typ
- časopisecké články MeSH
- práce podpořená grantem MeSH
- Názvy látek
- DNA MeSH
- kationty MeSH
Metal ions are essential components for the survival of living organisms. For most species, intracellular and extracellular ionic conditions differ significantly. As G-quadruplexes (G4s) are ion-dependent structures, changes in the [Na+]/[K+] ratio may affect the folding of genomic G4s. More than 11000 putative G4 sequences in the human genome (hg19) contain at least two runs of three continuous cytosines, and these mixed G/C-rich sequences may form a quadruplex or a competing hairpin structure based on G-C base pairing. In this study, we examine how the [Na+]/[K+] ratio influences the structures of G/C-rich sequences. The natural G4 structure with a 9-nt long central loop, CEBwt, was chosen as a model sequence, and the loop bases were gradually replaced by cytosines. The series of CEB mutations revealed that the presence of cytosines in G4 loops does not prevent G4 folding or decrease G4 stability but increases the probability of forming a competing structure, either a hairpin or an intermolecular duplex. Slow conversion to the quadruplex in vitro (in a potassium-rich buffer) and cells was demonstrated by NMR. 'Shape-shifting' sequences may respond to [Na+]/[K+] changes with delayed kinetics.
Introducing the flow through the bioreactor has revolutionized in-cell NMR spectroscopy by prolonging the measurement time available to acquire spectral information about biomacromolecules in metabolically active cells. Bioreactor technology relies on immobilizer matrices, which secure cells in the active volume of the NMR coil and enable uniform perfusion of the growth medium, supplying fresh nutrients to the cells while removing toxic byproducts of their metabolism. The main drawbacks of commonly used matrices include the inability to recover intact cells post-measurement for additional analyses and/or requirements for specific operating temperatures. Here, we report on the development and characterization of a set of thermosensitive and nontoxic triblock copolymers based on poly(D,L-lactide)-b-poly(ethylene glycol)-b-poly(D,L-lactide) (PLA-PEG-PLA). Here, we show for the first time that these copolymers are suitable as immobilizer matrices for the acquisition of in-cell NMR spectra of nucleic acids and proteins over a commonly used sample temperature range of 15-40 °C and, importantly, allow recovery of cells after completion of in-cell NMR spectra acquisition. We compared the performances of currently used matrices in terms of cell viability (dye exclusion assays), cellular metabolism (1D 31P NMR), and quality of in-cell NMR spectra of two model biomacromolecules (hybrid double-stranded/i-motif DNA and ubiquitin). Our results demonstrate the suitability and advantages of PLA-PEG-PLA copolymers for application in bioreactor-assisted in-cell NMR.
- Klíčová slova
- Bioreactor, Cell immobilization, In-cell NMR, PLA-PEG-PLA, Thermosensitive hydrogel,
- MeSH
- bioreaktory MeSH
- DNA MeSH
- magnetická rezonanční spektroskopie MeSH
- nukleární magnetická rezonance biomolekulární MeSH
- nukleové kyseliny * MeSH
- polymery chemie MeSH
- Publikační typ
- časopisecké články MeSH
- Názvy látek
- DNA MeSH
- nukleové kyseliny * MeSH
- polylactide-polyethylene glycol-polylactide MeSH Prohlížeč
- polymery MeSH
- MeSH
- konformace nukleové kyseliny MeSH
- nukleové kyseliny * MeSH
- Publikační typ
- časopisecké články MeSH
- Názvy látek
- nukleové kyseliny * MeSH
Cytosine-rich DNA regions can form four-stranded structures based on hemi-protonated C.C+ pairs, called i-motifs (iMs). Using CD, UV absorption, NMR spectroscopy, and DSC calorimetry, we show that model (CnT3)3Cn (Cn) sequences adopt iM under neutral or slightly alkaline conditions for n > 3. However, the iMs are formed with long-lasting kinetics under these conditions and melt with significant hysteresis. Sequences with n > 6 melt in two or more separate steps, indicating the presence of different iM species, the proportion of which is dependent on temperature and incubation time. At ambient temperature, kinetically favored iMs of low stability are formed, most likely consisting of short C.C+ blocks. These species act as kinetic traps and prevent the assembly of thermodynamically favored, fully C.C+ paired iMs. A higher temperature is necessary to unfold the kinetic forms and enable their substitution by a slowly developing thermodynamic structure. This complicated kinetic partitioning process considerably slows down iM folding, making it much slower than the timeframes of biological reactions and, therefore, unlikely to have any biological relevance. Our data suggest kinetically driven iM species as more likely to be biologically relevant than thermodynamically most stable iM forms.
- MeSH
- DNA * genetika chemie MeSH
- kinetika MeSH
- koncentrace vodíkových iontů MeSH
- konformace nukleové kyseliny MeSH
- nukleotidové motivy MeSH
- Publikační typ
- časopisecké články MeSH
- práce podpořená grantem MeSH
- Názvy látek
- DNA * MeSH
Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.
- Klíčová slova
- CD spectroscopy, DNA quadruplexes, G-quartets, NMR spectroscopy, molecular dynamics calculations, nucleic acid folding,
- MeSH
- DNA genetika MeSH
- G-kvadruplexy * MeSH
- guanin MeSH
- promotorové oblasti (genetika) MeSH
- sekvence nukleotidů MeSH
- Publikační typ
- časopisecké články MeSH
- Názvy látek
- DNA MeSH
- guanin MeSH
Recently, the 1H-detected in-cell NMR spectroscopy has emerged as a unique tool allowing the characterization of interactions between nucleic acid-based targets and drug-like molecules in living human cells. Here, we assess the application potential of 1H and 19F-detected in-cell NMR spectroscopy to profile drugs/ligands targeting DNA G-quadruplexes, arguably the most studied class of anti-cancer drugs targeting nucleic acids. We show that the extension of the original in-cell NMR approach is not straightforward. The severe signal broadening and overlap of 1H in-cell NMR spectra of polymorphic G-quadruplexes and their complexes complicate their quantitative interpretation. Nevertheless, the 1H in-cell NMR can be used to identify drugs that, despite strong interaction in vitro, lose their ability to bind G-quadruplexes in the native environment. The in-cell NMR approach is adjusted to a recently developed 3,5-bis(trifluoromethyl)phenyl probe to monitor the intracellular interaction with ligands using 19F-detected in-cell NMR. The probe allows dissecting polymorphic mixture in terms of number and relative populations of individual G-quadruplex species, including ligand-bound and unbound forms in vitro and in cellulo. Despite the probe's discussed limitations, the 19F-detected in-cell NMR appears to be a promising strategy to profile G-quadruplex-ligand interactions in the complex environment of living cells.
- Klíčová slova
- BRACO19, Bcl2, G-quadruplex, KRAS, NMM, PhenDC3, drug, in-cell NMR, ligand, telomeric DNA,
- MeSH
- DNA chemie účinky léků MeSH
- G-kvadruplexy účinky léků MeSH
- konformace nukleové kyseliny účinky léků MeSH
- léčivé přípravky chemie MeSH
- lidé MeSH
- ligandy MeSH
- magnetická rezonanční spektroskopie MeSH
- molekulární modely MeSH
- protony MeSH
- vazebná místa účinky léků MeSH
- Check Tag
- lidé MeSH
- Publikační typ
- časopisecké články MeSH
- Názvy látek
- DNA MeSH
- léčivé přípravky MeSH
- ligandy MeSH
- protony MeSH
Recent studies indicate that i-DNA, a four-stranded cytosine-rich DNA also known as the i-motif, is actually formed in vivo; however, a systematic study on sequence effects on stability has been missing. Herein, an unprecedented number of different sequences (271) bearing four runs of 3-6 cytosines with different spacer lengths has been tested. While i-DNA stability is nearly independent on total spacer length, the central spacer plays a special role on stability. Stability also depends on the length of the C-tracts at both acidic and neutral pHs. This study provides a global picture on i-DNA stability thanks to the large size of the introduced data set; it reveals unexpected features and allows to conclude that determinants of i-DNA stability do not mirror those of G-quadruplexes. Our results illustrate the structural roles of loops and C-tracts on i-DNA stability, confirm its formation in cells, and allow establishing rules to predict its stability.
- Klíčová slova
- DNA, i-motif, intracellular stability, pH transition, thermal stability,
- Publikační typ
- časopisecké články MeSH
- práce podpořená grantem MeSH