Germline TP53 mutations are found in only 70% of families with the Li-Fraumeni syndrome (LFS), and with an even lower frequency in families suggestive of LFS but not meeting clinical criteria of the syndrome. Despite intense efforts, to date, no other genes have been associated with the disorder in a significant number of TP53 mutation-negative families. A search for defects in TP53 other than heterozygous missense mutations showed that neither intron variants nor sequence variants in the TP53 promoter are frequent in LFS, and multiexon deletions have been found to be responsible for LFS only in several cases. Another cancer predisposition syndrome, hereditary non-polyposis colon cancer, has been associated with epigenetic silencing of one allele of the MLH1 or MSH2 genes. This prompted us to test the methylation of the TP53 gene promoter in a set of 14 families suggestive of LFS using bisulphite sequencing of three DNA fragments from the 5' region of the gene. We found no detectable methylation at any of the CG dinucleotides tested. Thus, epigenetic silencing of the TP53 promoter is not a frequent cause of the disorder in families suggestive of LFS but with no germline mutations in the coding part of the gene.

• MeSH
• geny p53 * MeSH
• lidé MeSH
• Liův-Fraumeniho syndrom genetika   MeSH
• metylace DNA * MeSH
• nádorový supresorový protein p53 genetika   MeSH
• nádory genetika   MeSH
• polymerázová řetězová reakce MeSH
• promotorové oblasti (genetika) genetika   MeSH
• rodina MeSH
• sekvenční analýza DNA MeSH
• zárodečné mutace * MeSH
• Check Tag
• lidé MeSH
• mužské pohlaví MeSH
• ženské pohlaví MeSH
• Publikační typ
• časopisecké články MeSH
• práce podpořená grantem MeSH
• Názvy látek
• nádorový supresorový protein p53 MeSH
• TP53 protein, human MeSH Prohlížeč

In search of potential prognostic markers, we analyzed a large series of tissues of Barrett's esophagus and samples of adenocarcinomas arising in the terrain of Barrett's esophagus for TP53 gene mutations by direct sequencing of exons 5 to 9 of the TP53 gene. While 9 of 21 adenocarcinomas tested (42.9%) contained a TP53 mutation, none of 24 samples from Barrett's esophagus were mutated. This observation suggests that TP53 gene mutation may be a relatively late event in the progression from nondysplastic Barrett's esophagus to adenocarcinoma of esophagus. Therefore, TP53 gene mutations alone are not likely to represent a widely useful prognostic marker of the risk of progression to malignancy, at least not in Barrett's esophagus without dysplasia.

• MeSH
• adenokarcinom genetika   patologie   MeSH
• Barrettův syndrom genetika   patologie   MeSH
• biopsie MeSH
• DNA genetika   MeSH
• dospělí MeSH
• exony MeSH
• genetické markery MeSH
• geny p53 genetika   MeSH
• lidé středního věku MeSH
• lidé MeSH
• mutace * MeSH
• nádory jícnu genetika   patologie   MeSH
• polymerázová řetězová reakce MeSH
• prekancerózy genetika   patologie   MeSH
• progrese nemoci MeSH
• retrospektivní studie MeSH
• rizikové faktory MeSH
• senioři nad 80 let MeSH
• senioři MeSH
• Check Tag
• dospělí MeSH
• lidé středního věku MeSH
• lidé MeSH
• mužské pohlaví MeSH
• senioři nad 80 let MeSH
• senioři MeSH
• ženské pohlaví MeSH
• Publikační typ
• časopisecké články MeSH
• práce podpořená grantem MeSH
• srovnávací studie MeSH
• Názvy látek
• DNA MeSH
• genetické markery MeSH

Patients with chronic lymphocytic leukemia with deletion of the short arm of chromosome 17 (17p -) or mutation of the TP53 gene have significantly worse prognosis with a higher risk of progression to symptomatic disease, worse and shorter responses to chemo immunotherapy, and more frequent occurrence of Richters syndrome. TP53 deletion/ mutation is currently the only genetic abnormality that independently predicts response to treatment and also affects the choice of therapeutic approach in chronic lymphocytic leukemia. This work summarizes treatment options available for this poor prognosis variant of chronic lymphocytic leukemia. Traditional chemo immunotherapy (e. g. FCR) does not offer longterm disease control, and patients with TP53 deletion/ mutation were usually considered to undergo allogeneic bone marrow transplantation. New molecules from the group of BCR inhibitors or BCL2 antagonists achieve excellent efficacy in chronic lymphocytic leukemia with del17p even in relapsed/ refractory (R/ R) cases, with a higher percentage of responses and prolonged survival without progression. Clinical trials are ongoing to determine optimal therapeutic approach and to induce longterm remission of the disease. The new molecules change algorithms for treatment of patients with TP53 aberration, including indication for allogeneic transplantation. Especially younger patients should be consulted in centers of intensive hematological care to consider their inclusion into clinical trials testing new molecules or to indicate allogeneic transplantation at the optimal time.

• MeSH
• chronická lymfatická leukemie genetika   mortalita   terapie   MeSH
• geny p53 * MeSH
• lidé MeSH
• mutace * MeSH
• transplantace kostní dřeně MeSH
• Check Tag
• lidé MeSH
• Publikační typ
• anglický abstrakt MeSH
• časopisecké články MeSH
• práce podpořená grantem MeSH
• přehledy MeSH

BACKGROUND: The Li-Fraumeni syndrome is a relatively rare familial cancer syndrome associated with germline mutations in the tumour-suppressor gene TP53. Members of affected families can suffer from a wide variety of tumours. Identification of a germline TP53 mutation is particularly important in families of patients affected by one of several characteristic types of tumours. METHODS AND RESULTS: The data used for the distribution analysis of mean age at the cancer diagnosis in TP53 mutation carriers and in the Czech population were extracted from a database of 176 families (469 cancers in 346 patients) with germline TP53 mutations and from Czech statistical data of cancer incidence in years 1994 to 1998 (UZIS). The comparison of the age distribution of the relative tumour incidence in these two groups clearly separated childhood adrenocortical sarcoma, rhabdomyosarcoma, osteosarcoma and brain tumour patients. In their families genetic counselling should be recommended. CONCLUSIONS: Patients with low age at diagnosis of these tumours, particularly patients with additional personal or family history of malignancy, should be considered as potential TP53 mutation carriers. It should be relevant not only for the treatment and follow-up of the patients but also for preventive measures aimed at other members of their families.

• MeSH
• dospělí MeSH
• genetická predispozice k nemoci MeSH
• geny p53 genetika   MeSH
• incidence MeSH
• lidé středního věku MeSH
• lidé MeSH
• Liův-Fraumeniho syndrom epidemiologie   genetika   MeSH
• mladiství MeSH
• předškolní dítě MeSH
• zárodečné mutace * MeSH
• Check Tag
• dospělí MeSH
• lidé středního věku MeSH
• lidé MeSH
• mladiství MeSH
• mužské pohlaví MeSH
• předškolní dítě MeSH
• ženské pohlaví MeSH
• Publikační typ
• anglický abstrakt MeSH
• časopisecké články MeSH
• práce podpořená grantem MeSH
• Geografické názvy
• Česká republika epidemiologie   MeSH

Infrequent and rare genetic variants in the human population vastly outnumber common ones. Although they may contribute significantly to the genetic basis of a disease, these seldom-encountered variants may also be miss-identified as pathogenic if no correct references are available. Somatic and germline TP53 variants are associated with multiple neoplastic diseases, and thus have come to serve as a paradigm for genetic analyses in this setting. We searched 14 independent, globally distributed datasets and recovered TP53 SNPs from 202,767 cancer-free individuals. In our analyses, 19 new missense TP53 SNPs, including five novel variants specific to the Asian population, were recurrently identified in multiple datasets. Using a combination of in silico, functional, structural, and genetic approaches, we showed that none of these variants displayed loss of function compared to the normal TP53 gene. In addition, classification using ACMG criteria suggested that they are all benign. Considered together, our data reveal that the TP53 coding region shows far more polymorphism than previously thought and present high ethnic diversity. They furthermore underline the importance of correctly assessing novel variants in all variant-calling pipelines associated with genetic diagnoses for cancer.

• MeSH
• geny p53 genetika   MeSH
• jednonukleotidový polymorfismus genetika   MeSH
• lidé MeSH
• missense mutace genetika   MeSH
• nádorový supresorový protein p53 genetika   MeSH
• nádory genetika   MeSH
• Check Tag
• lidé MeSH
• Publikační typ
• časopisecké články MeSH
• práce podpořená grantem MeSH
• Názvy látek
• nádorový supresorový protein p53 MeSH

A functionally normal TP53 is essential to protect organisms from developing cancer. Somatic mutations in the gene represent one of the highest recurring perturbations in human tumours, including colorectal cancer (CRC). However, the variegated phenotype of wide spectrum of somatic mutations in TP53 and the complexity of the disease prevent a straight interpretation of the mutational analysis in tumours. In addition to the presence of somatic mutations, polymorphic features of the gene may also contribute to alteration of the normal TP53 functioning and variants, mainly in the form of single nucleotide polymorphisms, can be expected to impact susceptibility to sporadic CRC. In the present study, we reviewed the potential role of alterations in the TP53 gene, both somatic mutations and inherited sequence variations, in predisposition to CRC and in the prognosis and response to therapy. The available data from association studies have mostly shown contradictory outcomes. The majority of the studies were based on limited sample sizes and focussed on a limited number of polymorphisms, with main being the rs1042522 (Arg72Pro). Thus far, there is no possible generalisation of the role of TP53 as also a predictor of therapeutic response and prognosis. The effects of TP53, and its abnormalities, on the response of tumours to cytotoxic drugs, radiation and chemoradiation are complex. However, from studies it is emerging that the inherited genetics of TP53 pathway components could be utilised to further define patient populations in their abilities to induce p53 activity in response to either DNA damaging or p53-targeted therapies.

• MeSH
• genetická predispozice k nemoci * MeSH
• kolorektální nádory genetika   MeSH
• lidé MeSH
• mutace genetika   MeSH
• nádorový supresorový protein p53 genetika   MeSH
• polymorfismus genetický genetika   MeSH
• prognóza MeSH
• Check Tag
• lidé MeSH
• Publikační typ
• časopisecké články MeSH
• práce podpořená grantem MeSH
• přehledy MeSH
• Názvy látek
• nádorový supresorový protein p53 MeSH
• TP53 protein, human MeSH Prohlížeč

We have examined the chicken TP53 tumor suppressor gene in v-src-transformed chicken tumor cells by reverse transcriptase-polymerase chain reaction and deoxyribonucleic acid (DNA) sequencing. Initially, we have detected frequent deletions of variable length in both DNA-binding and oligomerization domains of the TP53 in late as well as early in vitro passages of the chicken tumor cell line PR9692. This tumor cell line shows an immortal phenotype and acquires a metastatic potential that is unique in our experimental model of v-src-induced tumors in congenic chickens. Deletions in TP53 were also detected in an early passage of parallel in vivo subculture of the original v-src-induced tumor. In this case, tumor cells underwent replicative senescence later in tissue culture. Our results suggest that extensive deletions are efficient mechanisms of TP53 inactivation, occurring as early events during the immortalization of v-src-transformed chicken cells. Tumor cells with altered TP53 might, however, still be susceptible to growth control mechanisms, leading to withdrawal from the mitotic cycle in the early stage of the tumor lifeline.

• MeSH
• geny p53 * MeSH
• geny src * MeSH
• kur domácí genetika   MeSH
• metastázy nádorů MeSH
• molekulární sekvence - údaje MeSH
• nádorová transformace buněk * MeSH
• nádorové buněčné linie MeSH
• sekvence nukleotidů MeSH
• sekvenční seřazení MeSH
• transformované buněčné linie MeSH
• umlčování genů MeSH
• zvířata MeSH
• Check Tag
• zvířata MeSH
• Publikační typ
• časopisecké články MeSH
• práce podpořená grantem MeSH

High-grade serous ovarian carcinoma (HGSC) is the most common subtype of ovarian cancer and is among the most fatal gynecological malignancies worldwide, due to late diagnosis at advanced stages and frequent therapy resistance. In 47 HGSC patients, we assessed somatic and germline genetic variability of a custom panel of 144 known or suspected HGSC-related genes by high-coverage targeted DNA sequencing to identify the genetic determinants associated with resistance to platinum-based therapy. In the germline, the most mutated genes were DNAH14 (17%), RAD51B (17%), CFTR (13%), BRCA1 (11%), and RAD51 (11%). Somatically, the most mutated gene was TP53 (98%), followed by CSMD1/2/3 (19/19/36%), and CFTR (23%). Results were compared with those from whole exome sequencing of a similar set of 35 HGSC patients. Somatic variants in TP53 were also validated using GENIE data of 1287 HGSC samples. Our approach showed increased prevalence of high impact somatic and germline mutations, especially those affecting splice sites of TP53, compared to validation datasets. Furthermore, nonsense TP53 somatic mutations were negatively associated with patient survival. Elevated TP53 transcript levels were associated with platinum resistance and presence of TP53 missense mutations, while decreased TP53 levels were found in tumors carrying mutations with predicted high impact, which was confirmed in The Cancer Genome Atlas data (n = 260). Targeted DNA sequencing of TP53 combined with transcript quantification may contribute to the concept of precision oncology of HGSC. Future studies should explore targeting the p53 pathway based on specific mutation types and co-analyze the expression and mutational profiles of other key cancer genes.

• Klíčová slova
• TP53, biomarkers, ovarian carcinoma, platinum resistance, treatment response,
• MeSH
• chemorezistence * genetika   MeSH
• dospělí MeSH
• lidé středního věku MeSH
• lidé MeSH
• mutace MeSH
• nádorový supresorový protein p53 * genetika   MeSH
• nádory vaječníků * genetika   farmakoterapie   patologie   MeSH
• platina terapeutické užití   farmakologie   MeSH
• regulace genové exprese u nádorů MeSH
• sekvenování exomu metody   MeSH
• senioři MeSH
• serózní cystadenokarcinom * genetika   farmakoterapie   patologie   MeSH
• zárodečné mutace MeSH
• Check Tag
• dospělí MeSH
• lidé středního věku MeSH
• lidé MeSH
• senioři MeSH
• ženské pohlaví MeSH
• Publikační typ
• časopisecké články MeSH
• práce podpořená grantem MeSH
• Názvy látek
• nádorový supresorový protein p53 * MeSH
• platina MeSH
• TP53 protein, human MeSH Prohlížeč

An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.

• Klíčová slova
• 53BP1, AFM, DNA damage, Epigenetics, FLIM-FRET, Mass spectrometry, p53,
• MeSH
• DNA metabolismus   MeSH
• fosforylace MeSH
• geny p53 * MeSH
• nádorový supresorový protein p53 * genetika   metabolismus   MeSH
• oprava DNA MeSH
• poškození DNA MeSH
• Publikační typ
• časopisecké články MeSH
• Názvy látek
• DNA MeSH
• nádorový supresorový protein p53 * MeSH

53BP1 is a very well-known protein that is recruited to DNA lesions. The focal accumulation of p53 binding protein, 53BP1, is a main feature indicating the repair of spontaneous or irradiation-induced foci (IRIF). Thus, here, we addressed the question of whether mutations in the TP53 gene, which often affect the level of p53 protein, can change the recruitment of 53BP1 to γ- or UVA-irradiated chromatin. In various TP53 mutants, we observed a distinct accumulation of 53BP1 protein to UV-induced DNA lesions: in R273C mutants, 53BP1 appeared transiently at DNA lesions, during 10-30 min after irradiation; the mutation R282W was responsible for accumulation of 53BP1 immediately after UVA-damage; and in L194F mutants, the first appearance of 53BP1 protein at the lesions occurred during 60-70 min. These results showed that specific mutations in the TP53 gene stand behind not only different levels of p53 protein, but also affect the localized kinetics of 53BP1 protein in UVA-damaged chromatin. However, after γ-irradiation, only G245S mutation in TP53 gene was associated with surprisingly decreased level of 53BP1 protein. In other mutant cell lines, levels of 53BP1 were not affected by γ-rays. To these effects, we conversely found a distinct number of 53BP1-positive irradiation-induced foci in various TP53 mutants. The R280K, G245S, L194F mutations, or TP53 deletion were also characterized by radiation-induced depletion in MDC1 protein. Moreover, in mutant cells, an interaction between MDC1 and 53BP1 proteins was abrogated when compared with wild-type counterpart. Together, the kinetics of 53BP1 accumulation at UV-induced DNA lesions is different in various TP53 mutant cells. After γ-irradiation, despite changes in a number and a volume of 53BP1-positive foci, levels of 53BP1 protein were relatively stable. Here, we showed a link between the status of MDC1 protein and TP53 gene, which specific mutations caused radiation-induced MDC1 down-regulation. This observation is significant, especially with regard to radiotherapy of tumors with abrogated function of TP53 gene.

• Klíčová slova
• 53BP1 protein, DNA repair, Histone γH2AX, MDC1 protein, TP53 gene,
• MeSH
• 53BP1 metabolismus   MeSH
• adaptorové proteiny signální transdukční MeSH
• down regulace MeSH
• jaderné proteiny nedostatek   metabolismus   MeSH
• lidé MeSH
• mutace * MeSH
• nádorové buňky kultivované MeSH
• nádorový supresorový protein p53 nedostatek   genetika   metabolismus   MeSH
• poškození DNA * MeSH
• proteiny buněčného cyklu MeSH
• trans-aktivátory nedostatek   metabolismus   MeSH
• ultrafialové záření * MeSH
• Check Tag
• lidé MeSH
• Publikační typ
• časopisecké články MeSH
• Názvy látek
• 53BP1 MeSH
• adaptorové proteiny signální transdukční MeSH
• jaderné proteiny MeSH
• MDC1 protein, human MeSH Prohlížeč
• nádorový supresorový protein p53 MeSH
• proteiny buněčného cyklu MeSH
• TP53 protein, human MeSH Prohlížeč
• TP53BP1 protein, human MeSH Prohlížeč
• trans-aktivátory MeSH