Q95485728
Dotaz
Zobrazit nápovědu
FTO and ALKBH5 proteins are essential erasers of N6-adenosine methylation in RNA. We studied how levels of FTO and ALKBH5 proteins changed during mouse embryonic development, aging, cardiomyogenesis, and neuroectodermal differentiation. We observed that aging in male and female mice was associated with FTO up-regulation in mouse hearts, brains, lungs, and kidneys, while the ALKBH5 level remained stable. FTO and ALKBH5 proteins were up-regulated during experimentally induced cardiomyogenesis, but the level of ALKBH5 protein was not changed when neuroectodermal differentiation was induced. HDAC1 depletion in mouse ES cells caused FTO down-regulation. In these cells, mRNA, carrying information from genes that regulate histone signature, RNA processing, and cell differentiation, was characterized by a reduced level of N6-adenosine methylation in specific gene loci, primarily regulating cell differentiation into neuroectoderm. Together, when we compared both RNA demethylating proteins, the FTO protein level undergoes the most significant changes during cell differentiation and aging. Thus, we conclude that during aging and neuronal differentiation, m6A RNA demethylation is likely regulated by the FTO protein but not via the function of ALKBH5.
- MeSH
- adenosin metabolismus MeSH
- alfa-ketoglutarát-dependentní dioxygenasa, AlkB homolog 5 * genetika metabolismus MeSH
- buněčná diferenciace MeSH
- embryonální vývoj MeSH
- gen pro FTO * genetika metabolismus MeSH
- myši MeSH
- RNA metabolismus MeSH
- stárnutí genetika MeSH
- upregulace MeSH
- zvířata MeSH
- Check Tag
- mužské pohlaví MeSH
- myši MeSH
- ženské pohlaví MeSH
- zvířata MeSH
- Publikační typ
- časopisecké články MeSH
RNA modifications have been known for many years, but their function has not been fully elucidated yet. For instance, the regulatory role of acetylation on N4-cytidine (ac4C) in RNA can be explored not only in terms of RNA stability and mRNA translation but also in DNA repair. Here, we observe a high level of ac4C RNA at DNA lesions in interphase cells and irradiated cells in telophase. Ac4C RNA appears in the damaged genome from 2 to 45 min after microirradiation. However, RNA cytidine acetyltransferase NAT10 did not accumulate to damaged sites, and NAT10 depletion did not affect the pronounced recruitment of ac4C RNA to DNA lesions. This process was not dependent on the G1, S, and G2 cell cycle phases. In addition, we observed that the PARP inhibitor, olaparib, prevents the recruitment of ac4C RNA to damaged chromatin. Our data imply that the acetylation of N4-cytidine, especially in small RNAs, has an important role in mediating DNA damage repair. Ac4C RNA likely causes de-condensation of chromatin in the vicinity of DNA lesions, making it accessible for other DNA repair factors involved in the DNA damage response. Alternatively, RNA modifications, including ac4C, could be direct markers of damaged RNAs.
- MeSH
- acetylace MeSH
- chromatin MeSH
- cytidin * genetika metabolismus MeSH
- PARP inhibitory MeSH
- RNA * metabolismus MeSH
- Publikační typ
- časopisecké články MeSH
An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.
BACKGROUND: Variants of linker histone H1 are tissue-specific and are responsible for chromatin compaction accompanying cell differentiation, mitotic chromosome condensation, and apoptosis. Heterochromatinization, as the main feature of these processes, is also associated with pronounced trimethylation of histones H3 at the lysine 9 position (H3K9me3). METHODS: By confocal microscopy, we analyzed cell cycle-dependent levels and distribution of phosphorylated histone H1 (H1ph) and H3K9me3. By mass spectrometry, we studied post-translational modifications of linker histones. RESULTS: Phosphorylated histone H1, similarly to H3K9me3, has a comparable level in the G1, S, and G2 phases of the cell cycle. A high density of phosphorylated H1 was inside nucleoli of mouse embryonic stem cells (ESCs). H1ph was also abundant in prophase and prometaphase, while H1ph was absent in anaphase and telophase. H3K9me3 surrounded chromosomal DNA in telophase. This histone modification was barely detectable in the early phases of mitosis. Mass spectrometry revealed several ESC-specific phosphorylation sites of H1. HDAC1 depletion did not change H1 acetylation but potentiated phosphorylation of H1.2/H1.3 and H1.4 at serine 38 positions. CONCLUSIONS: Differences in the level and distribution of H1ph and H3K9me3 were revealed during mitotic phases. ESC-specific phosphorylation sites were identified in a linker histone.
- Publikační typ
- časopisecké články MeSH
RNA methylation, especially 6-methyladenosine (m6A)-modified RNAs, plays a specific role in DNA damage response (DDR). Here, we also observe that RNA modified at 8-methyladenosine (m8A) is recruited to UVA-damaged chromatin immediately after microirradiation. Interestingly, the level of m8A RNA at genomic lesions was reduced after inhibition of histone deacetylases and DNA methyltransferases. It appears in later phases of DNA damage response, accompanied by active DNA demethylation. Also, PARP inhibitor (PARPi), Olaparib, prevented adenosine methylation at microirradiated chromatin. PARPi abrogated not only m6A and m8A RNA positivity at genomic lesions, but also XRCC1, the factor of base excision repair (BER), did not recognize lesions in DNA. To this effect, Olaparib enhanced the genome-wide level of γH2AX. This histone modification interacted with m8A RNAs to a similar extent as m8A RNAs with DNA. Pronounced interaction properties we did not observe for m6A RNAs and DNA; however, m6A RNA interacted with XRCC1 with the highest efficiency, especially in microirradiated cells. Together, we show that the recruitment of m6A RNA and m8A RNA to DNA lesions is PARP dependent. We suggest that modified RNAs likely play a role in the BER mechanism accompanied by active DNA demethylation. In this process, γH2AX stabilizes m6A/m8A-positive RNA-DNA hybrid loops via its interaction with m8A RNAs. R-loops could represent basic three-stranded structures recognized by PARP-dependent non-canonical m6A/m8A-mediated DNA repair pathway.
METTL16 methyltransferase is responsible for the methylation of N6-adenosine (m6A) in several RNAs. In mouse cells, we showed that the nuclear distribution of METTL16 is cell cycle-specific. In the G1/S phases, METTL16 accumulates to the nucleolus, while in the G2 phase, the level of METTL16 increases in the nucleoplasm. In metaphase and anaphase, there is a very low pool of the METTL16 protein, but in telophase, residual METTL16 appears to be associated with the newly formed nuclear lamina. In A-type lamin-depleted cells, we observed a reduction of METTL16 when compared with the wild-type counterpart. However, METTL16 does not interact with A-type and B-type lamins, but interacts with Lamin B Receptor (LBR) and Lap2α. Additionally, Lap2α depletion caused METTL16 downregulation in the nuclear pool. Furthermore, METTL16 interacted with DDB2, a key protein of the nucleotide excision repair (NER), and also with nucleolar proteins, including TCOF, NOLC1, and UBF1/2, but not fibrillarin. From this view, the METTL16 protein may also regulate the transcription of ribosomal genes because we observed that the high level of m6A in 18S rRNA appeared in cells with upregulated METTL16.
- Publikační typ
- časopisecké články MeSH
G-quadruplexes (G4s) are four-stranded helical structures that regulate several nuclear processes, including gene expression and telomere maintenance. We observed that G4s are located in GC-rich (euchromatin) regions and outside the fibrillarin-positive compartment of nucleoli. Genomic regions around G4s were preferentially H3K9 acetylated and H3K9 dimethylated, but H3K9me3 rarely decorated G4 structures. We additionally observed the variability in the number of G4s in selected human and mouse cell lines. We found the highest number of G4s in human embryonic stem cells. We observed the highest degree of colocalization between G4s and transcription factories, positive on the phosphorylated form of RNA polymerase II (RNAP II). Similarly, a high colocalization rate was between G4s and nuclear speckles, enriched in pre-mRNA splicing factor SC-35. PML bodies, the replication protein SMD1, and Cajal bodies colocalized with G4s to a lesser extent. Thus, G4 structures seem to appear mainly in nuclear compartments transcribed via RNAP II, and pre-mRNA is spliced via the SC-35 protein. However, α-amanitin, an inhibitor of RNAP II, did not affect colocalization between G4s and transcription factories as well as G4s and SC-35-positive domains. In addition, irradiation by γ-rays did not change a mutual link between G4s and DNA repair proteins (G4s/γH2AX, G4s/53BP1, and G4s/MDC1), accumulated into DNA damage foci. Described characteristics of G4s seem to be the manifestation of pronounced G4s stability that is likely maintained not only via a high-order organization of these structures but also by a specific histone signature, including H3K9me2, responsible for chromatin compaction.
- MeSH
- acetylace MeSH
- buněčná inkluze metabolismus MeSH
- buněčné jadérko metabolismus MeSH
- buněčné jádro metabolismus MeSH
- buněčné linie MeSH
- chromatin metabolismus MeSH
- DNA metabolismus MeSH
- epigeneze genetická MeSH
- G-kvadruplexy * MeSH
- genetická transkripce * MeSH
- histony metabolismus MeSH
- lidé MeSH
- metylace MeSH
- myši MeSH
- oprava DNA MeSH
- zastoupení bazí genetika MeSH
- zvířata MeSH
- Check Tag
- lidé MeSH
- myši MeSH
- zvířata MeSH
- Publikační typ
- časopisecké články MeSH
The essential components of splicing are the splicing factors accumulated in nuclear speckles; thus, we studied how DNA damaging agents and A-type lamin depletion affect the properties of these regions, positive on the SC-35 protein. We observed that inhibitor of PARP (poly (ADP-ribose) polymerase), and more pronouncedly inhibitors of RNA polymerases, caused DNA damage and increased the SC35 protein level. Interestingly, nuclear blebs, induced by PARP inhibitor and observed in A-type lamin-depleted or senescent cells, were positive on both the SC-35 protein and another component of the spliceosome, SRRM2. In the interphase cell nuclei, SC-35 interacted with the phosphorylated form of RNAP II, which was A-type lamin-dependent. In mitotic cells, especially in telophase, the SC35 protein formed a well-visible ring in the cytoplasmic fraction and colocalized with β-catenin, associated with the plasma membrane. The antibody against the SRRM2 protein showed that nuclear speckles are already established in the cytoplasm of the late telophase and at the stage of early cytokinesis. In addition, we observed the occurrence of splicing factors in the nuclear blebs and micronuclei, which are also sites of both transcription and splicing. This conclusion supports the fact that splicing proceeds transcriptionally. According to our data, this process is A-type lamin-dependent. Lamin depletion also reduces the interaction between SC35 and β-catenin in mitotic cells.
- MeSH
- HeLa buňky MeSH
- laminy metabolismus MeSH
- lidé MeSH
- nádorové buněčné linie MeSH
- PARP inhibitory terapeutické užití MeSH
- poly(ADP-ribosa)polymerasa 1 MeSH
- RNA-polymerasa II metabolismus MeSH
- sestřihové faktory metabolismus MeSH
- Check Tag
- lidé MeSH
- Publikační typ
- časopisecké články MeSH
- práce podpořená grantem MeSH
ACE2 was observed as the cell surface receptor of the SARS-CoV-2 virus. Interestingly, we also found ACE2 positivity inside the cell nucleus. The ACE2 levels changed during cell differentiation and aging and varied in distinct cell types. We observed ACE2 depletion in the aortas of aging female mice, similarly, the aging caused ACE2 decrease in the kidneys. Compared with that in the heart, brain and kidneys, the ACE2 level was the lowest in the mouse lungs. In mice exposed to nicotine, ACE2 was not changed in olfactory bulbs but in the lungs, ACE2 was upregulated in females and downregulated in males. These observations indicate the distinct gender-dependent properties of ACE2. Differentiation into enterocytes, and cardiomyocytes, caused ACE2 depletion. The cardiomyogenesis was accompanied by renin upregulation, delayed in HDAC1-depleted cells. In contrast, vitamin D2 decreased the renin level while ACE2 was upregulated. Together, the ACE2 level is high in non-differentiated cells. This protein is more abundant in the tissues of mouse embryos and young mice in comparison with older animals. Mostly, downregulation of ACE2 is accompanied by renin upregulation. Thus, the pathophysiology of COVID-19 disease should be further studied not only by considering the ACE2 level but also the whole renin-angiotensin system.
- MeSH
- angiotensin-konvertující enzym 2 metabolismus MeSH
- buněčná diferenciace fyziologie MeSH
- buňky A549 MeSH
- buňky HT-29 MeSH
- COVID-19 epidemiologie patologie virologie MeSH
- HEK293 buňky MeSH
- lidé MeSH
- myši MeSH
- pandemie MeSH
- regulace genové exprese fyziologie MeSH
- renin-angiotensin systém fyziologie MeSH
- renin metabolismus MeSH
- SARS-CoV-2 patogenita MeSH
- sexuální faktory MeSH
- stárnutí fyziologie MeSH
- věkové faktory MeSH
- zvířata MeSH
- Check Tag
- lidé MeSH
- mužské pohlaví MeSH
- myši MeSH
- ženské pohlaví MeSH
- zvířata MeSH
- Publikační typ
- časopisecké články MeSH
- práce podpořená grantem MeSH
It has become evident that epitranscriptome events, mediated by specific enzymes, regulate gene expression and, subsequently, cell differentiation processes. We show that methyltransferase-like proteins METTL3/METTL14 and N6-adenosine methylation (m6A) in RNAs are homogeneously distributed in embryonic hearts, and histone deacetylase (HDAC) inhibitors valproic acid and Trichostatin A (TSA) up-regulate METTL3/METTL14 proteins. The levels of METTL3 in mouse adult hearts, isolated from male and female animals, were lower in the aorta and pulmonary trunks when compared with atria, but METT14 was up-regulated in the aorta and pulmonary trunk, in comparison with ventriculi. Aging caused METTL3 down-regulation in aorta and atria in male animals. Western blot analysis in differentiated mouse embryonic stem cells (mESCs), containing 10-30 percent of cardiomyocytes, showed METTL3/METTL14 down-regulation, while the differentiation-induced increased level of METTL16 was observed in both wild type (wt) and HDAC1 depleted (dn) cells. In parallel, experimental differentiation in especially HDAC1 wild type cells was accompanied by depletion of m6A in RNA. Immunofluorescence analysis of individual cells revealed the highest density of METTL3/METTL14 in α-actinin positive cardiomyocytes when compared with the other cells in the culture undergoing differentiation. In both wt and HDAC1 dn cells, the amount of METTL16 was also up-regulated in cardiomyocytes when compared to co-cultivated cells. Together, we showed that distinct anatomical regions of the mouse adult hearts are characterized by different levels of METTL3 and METTL14 proteins, which are changed during aging. Experimental cell differentiation was also accompanied by changes in METTL-like proteins and m6A in RNA; in particular, levels and distribution patterns of METTL3/METTL14 proteins were different from the same parameters studied in the case of the METTL16 protein.
- MeSH
- adenosin analogy a deriváty genetika metabolismus MeSH
- buněčná diferenciace MeSH
- HEK293 buňky MeSH
- HeLa buňky MeSH
- kardiomyocyty cytologie metabolismus MeSH
- lidé MeSH
- methyltransferasy metabolismus MeSH
- myší embryonální kmenové buňky cytologie metabolismus MeSH
- myši inbrední C57BL MeSH
- myši MeSH
- stárnutí metabolismus patologie MeSH
- zvířata MeSH
- Check Tag
- lidé MeSH
- mužské pohlaví MeSH
- myši MeSH
- ženské pohlaví MeSH
- zvířata MeSH
- Publikační typ
- časopisecké články MeSH
