The affiliation number 1, "Institute of Biophysics of the Czech Academy of Sciences, Královopolská 135, 612 65 Brno, Czech Republic" changed its zip code to 612 00 [...].
- Publikační typ
- tisková chyba MeSH
An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.
BACKGROUND: Variants of linker histone H1 are tissue-specific and are responsible for chromatin compaction accompanying cell differentiation, mitotic chromosome condensation, and apoptosis. Heterochromatinization, as the main feature of these processes, is also associated with pronounced trimethylation of histones H3 at the lysine 9 position (H3K9me3). METHODS: By confocal microscopy, we analyzed cell cycle-dependent levels and distribution of phosphorylated histone H1 (H1ph) and H3K9me3. By mass spectrometry, we studied post-translational modifications of linker histones. RESULTS: Phosphorylated histone H1, similarly to H3K9me3, has a comparable level in the G1, S, and G2 phases of the cell cycle. A high density of phosphorylated H1 was inside nucleoli of mouse embryonic stem cells (ESCs). H1ph was also abundant in prophase and prometaphase, while H1ph was absent in anaphase and telophase. H3K9me3 surrounded chromosomal DNA in telophase. This histone modification was barely detectable in the early phases of mitosis. Mass spectrometry revealed several ESC-specific phosphorylation sites of H1. HDAC1 depletion did not change H1 acetylation but potentiated phosphorylation of H1.2/H1.3 and H1.4 at serine 38 positions. CONCLUSIONS: Differences in the level and distribution of H1ph and H3K9me3 were revealed during mitotic phases. ESC-specific phosphorylation sites were identified in a linker histone.
- Publikační typ
- časopisecké články MeSH
RNA methylation, especially 6-methyladenosine (m6A)-modified RNAs, plays a specific role in DNA damage response (DDR). Here, we also observe that RNA modified at 8-methyladenosine (m8A) is recruited to UVA-damaged chromatin immediately after microirradiation. Interestingly, the level of m8A RNA at genomic lesions was reduced after inhibition of histone deacetylases and DNA methyltransferases. It appears in later phases of DNA damage response, accompanied by active DNA demethylation. Also, PARP inhibitor (PARPi), Olaparib, prevented adenosine methylation at microirradiated chromatin. PARPi abrogated not only m6A and m8A RNA positivity at genomic lesions, but also XRCC1, the factor of base excision repair (BER), did not recognize lesions in DNA. To this effect, Olaparib enhanced the genome-wide level of γH2AX. This histone modification interacted with m8A RNAs to a similar extent as m8A RNAs with DNA. Pronounced interaction properties we did not observe for m6A RNAs and DNA; however, m6A RNA interacted with XRCC1 with the highest efficiency, especially in microirradiated cells. Together, we show that the recruitment of m6A RNA and m8A RNA to DNA lesions is PARP dependent. We suggest that modified RNAs likely play a role in the BER mechanism accompanied by active DNA demethylation. In this process, γH2AX stabilizes m6A/m8A-positive RNA-DNA hybrid loops via its interaction with m8A RNAs. R-loops could represent basic three-stranded structures recognized by PARP-dependent non-canonical m6A/m8A-mediated DNA repair pathway.
The essential components of splicing are the splicing factors accumulated in nuclear speckles; thus, we studied how DNA damaging agents and A-type lamin depletion affect the properties of these regions, positive on the SC-35 protein. We observed that inhibitor of PARP (poly (ADP-ribose) polymerase), and more pronouncedly inhibitors of RNA polymerases, caused DNA damage and increased the SC35 protein level. Interestingly, nuclear blebs, induced by PARP inhibitor and observed in A-type lamin-depleted or senescent cells, were positive on both the SC-35 protein and another component of the spliceosome, SRRM2. In the interphase cell nuclei, SC-35 interacted with the phosphorylated form of RNAP II, which was A-type lamin-dependent. In mitotic cells, especially in telophase, the SC35 protein formed a well-visible ring in the cytoplasmic fraction and colocalized with β-catenin, associated with the plasma membrane. The antibody against the SRRM2 protein showed that nuclear speckles are already established in the cytoplasm of the late telophase and at the stage of early cytokinesis. In addition, we observed the occurrence of splicing factors in the nuclear blebs and micronuclei, which are also sites of both transcription and splicing. This conclusion supports the fact that splicing proceeds transcriptionally. According to our data, this process is A-type lamin-dependent. Lamin depletion also reduces the interaction between SC35 and β-catenin in mitotic cells.
- MeSH
- HeLa buňky MeSH
- laminy metabolismus MeSH
- lidé MeSH
- nádorové buněčné linie MeSH
- PARP inhibitory terapeutické užití MeSH
- poly-ADP-ribóza-polymeráza 1 MeSH
- RNA-polymerasa II metabolismus MeSH
- sestřihové faktory metabolismus MeSH
- Check Tag
- lidé MeSH
- Publikační typ
- časopisecké články MeSH
- práce podpořená grantem MeSH
ACE2 was observed as the cell surface receptor of the SARS-CoV-2 virus. Interestingly, we also found ACE2 positivity inside the cell nucleus. The ACE2 levels changed during cell differentiation and aging and varied in distinct cell types. We observed ACE2 depletion in the aortas of aging female mice, similarly, the aging caused ACE2 decrease in the kidneys. Compared with that in the heart, brain and kidneys, the ACE2 level was the lowest in the mouse lungs. In mice exposed to nicotine, ACE2 was not changed in olfactory bulbs but in the lungs, ACE2 was upregulated in females and downregulated in males. These observations indicate the distinct gender-dependent properties of ACE2. Differentiation into enterocytes, and cardiomyocytes, caused ACE2 depletion. The cardiomyogenesis was accompanied by renin upregulation, delayed in HDAC1-depleted cells. In contrast, vitamin D2 decreased the renin level while ACE2 was upregulated. Together, the ACE2 level is high in non-differentiated cells. This protein is more abundant in the tissues of mouse embryos and young mice in comparison with older animals. Mostly, downregulation of ACE2 is accompanied by renin upregulation. Thus, the pathophysiology of COVID-19 disease should be further studied not only by considering the ACE2 level but also the whole renin-angiotensin system.
- MeSH
- angiotensin konvertující enzym 2 metabolismus MeSH
- buněčná diferenciace fyziologie MeSH
- buňky A549 MeSH
- buňky HT-29 MeSH
- COVID-19 epidemiologie patologie virologie MeSH
- HEK293 buňky MeSH
- lidé MeSH
- myši MeSH
- pandemie MeSH
- regulace genové exprese fyziologie MeSH
- renin-angiotensin systém fyziologie MeSH
- renin metabolismus MeSH
- SARS-CoV-2 patogenita MeSH
- sexuální faktory MeSH
- stárnutí fyziologie MeSH
- věkové faktory MeSH
- zvířata MeSH
- Check Tag
- lidé MeSH
- mužské pohlaví MeSH
- myši MeSH
- ženské pohlaví MeSH
- zvířata MeSH
- Publikační typ
- časopisecké články MeSH
- práce podpořená grantem MeSH
A microfluidic device made of polydimethylsiloxane was developed for continuous evaluation of natural migration mobility of many eukaryotic cells in relaxed and deformed state. The device was fabricated by standard photolithography and soft lithography techniques using the SU-8 3010 negative photoresist on a glass wafer as the master mold. The simple flow-free device exploits the chemotactic movement of cells through a set of mechanical barriers in the direction of concentration gradients of attractants. The barriers are formed by arrays of circular cross-section pillars with decreasing spacing 7, 5, and 3 μm. To pass through the obstacles, the cells are deformed and change their cytoskeletal architecture. The instantaneous migration velocities of cells are monitored in a time-lapse setup of the scanning confocal microscope. Thus, the cellular deformability and migratory activity can easily be evaluated. The functionality of the device was tested with model HeLa cells stably transfected with fluorescent Premo FUCCI Cell Cycle Sensor. The designed device has the potential to be implemented for testing the tendency of patients' tumors to metastasis.
- MeSH
- buněčné kultury přístrojové vybavení MeSH
- design vybavení MeSH
- dimethylpolysiloxany chemie MeSH
- HeLa buňky MeSH
- konfokální mikroskopie MeSH
- lidé MeSH
- mikrofluidní analytické techniky přístrojové vybavení MeSH
- pohyb buněk fyziologie MeSH
- tvar buňky fyziologie MeSH
- Check Tag
- lidé MeSH
- Publikační typ
- časopisecké články MeSH
- práce podpořená grantem MeSH
The DNA damage response is mediated by both DNA repair proteins and epigenetic markers. Here, we observe that N6-methyladenosine (m6A), a mark of the epitranscriptome, was common in RNAs accumulated at UV-damaged chromatin; however, inhibitors of RNA polymerases I and II did not affect the m6A RNA level at the irradiated genomic regions. After genome injury, m6A RNAs either diffused to the damaged chromatin or appeared at the lesions enzymatically. DNA damage did not change the levels of METTL3 and METTL14 methyltransferases. In a subset of irradiated cells, only the METTL16 enzyme, responsible for m6A in non-coding RNAs as well as for splicing regulation, was recruited to microirradiated sites. Importantly, the levels of the studied splicing factors were not changed by UVA light. Overall, if the appearance of m6A RNAs at DNA lesions is regulated enzymatically, this process must be mediated via the coregulatory function of METTL-like enzymes. This event is additionally accompanied by radiation-induced depletion of 2,2,7-methylguanosine (m3G/TMG) in RNA. Moreover, UV-irradiation also decreases the global cellular level of N1-methyladenosine (m1A) in RNAs. Based on these results, we prefer a model in which m6A RNAs rapidly respond to radiation-induced stress and diffuse to the damaged sites. The level of both (m1A) RNAs and m3G/TMG in RNAs is reduced as a consequence of DNA damage, recognized by the nucleotide excision repair mechanism.
- MeSH
- adenosin analogy a deriváty metabolismus MeSH
- chromatin metabolismus MeSH
- demetylace DNA účinky záření MeSH
- fyziologický stres účinky záření MeSH
- guanosin analogy a deriváty metabolismus MeSH
- metylace DNA genetika účinky záření MeSH
- metylace účinky záření MeSH
- myši MeSH
- nádorové buněčné linie MeSH
- nekódující RNA metabolismus MeSH
- nestabilita genomu účinky záření MeSH
- poškození DNA MeSH
- RNA metabolismus MeSH
- ultrafialové záření * MeSH
- zvířata MeSH
- Check Tag
- myši MeSH
- zvířata MeSH
- Publikační typ
- časopisecké články MeSH
- práce podpořená grantem MeSH
The family of heterochromatin protein 1 (HP1) isoforms is essential for chromatin packaging, regulation of gene expression, and repair of damaged DNA. Here we document that γ-radiation reduced the number of HP1α-positive foci, but not HP1β and HP1γ foci, located in the vicinity of the fibrillarin-positive region of the nucleolus. The additional analysis confirmed that γ-radiation has the ability to significantly decrease the level of HP1α in rDNA promoter and rDNA encoding 28S rRNA. By mass spectrometry, we showed that treatment by γ-rays enhanced the HP1β serine 88 phosphorylation (S88ph), but other analyzed modifications of HP1β, including S161ph/Y163ph, S171ph, and S174ph, were not changed in cells exposed to γ-rays or treated by the HDAC inhibitor (HDACi). Interestingly, a combination of HDACi and γ-radiation increased the level of HP1α and HP1γ. The level of HP1β remained identical before and after the HDACi/γ-rays treatment, but HDACi strengthened HP1β interaction with the KRAB-associated protein 1 (KAP1) protein. Conversely, HP1γ did not interact with KAP1, although approximately 40% of HP1γ foci co-localized with accumulated KAP1. Especially HP1γ foci at the periphery of nucleoli were mostly absent of KAP1. Together, DNA damage changed the morphology, levels, and interaction properties of HP1 isoforms. Also, γ-irradiation-induced hyperphosphorylation of the HP1β protein; thus, HP1β-S88ph could be considered as an important marker of DNA damage.
- MeSH
- buněčné jadérko metabolismus MeSH
- chromozomální proteiny, nehistonové metabolismus MeSH
- fosforylace MeSH
- HeLa buňky MeSH
- lidé MeSH
- nádorové buňky kultivované MeSH
- optické zobrazování MeSH
- poškození DNA MeSH
- rezonanční přenos fluorescenční energie MeSH
- serin metabolismus MeSH
- Check Tag
- lidé MeSH
- Publikační typ
- časopisecké články MeSH
- práce podpořená grantem MeSH
Nuclear architecture plays a significant role in DNA repair mechanisms. It is evident that proteins involved in DNA repair are compartmentalized in not only spontaneously occurring DNA lesions or ionizing radiation-induced foci (IRIF), but a specific clustering of these proteins can also be observed within the whole cell nucleus. For example, 53BP1-positive and BRCA1-positive DNA repair foci decorate chromocenters and can appear close to nuclear speckles. Both 53BP1 and BRCA1 are well-described factors that play an essential role in double-strand break (DSB) repair. These proteins are members of two protein complexes: 53BP1-RIF1-PTIP and BRCA1-CtIP, which make a "decision" determining whether canonical nonhomologous end joining (NHEJ) or homology-directed repair (HDR) is activated. It is generally accepted that 53BP1 mediates the NHEJ mechanism, while HDR is activated via a BRCA1-dependent signaling pathway. Interestingly, the 53BP1 protein appears relatively quickly at DSB sites, while BRCA1 is functional at later stages of DNA repair, as soon as the Mre11-Rad50-Nbs1 complex is recruited to the DNA lesions. A function of the 53BP1 protein is also linked to a specific histone signature, including phosphorylation of histone H2AX (γH2AX) or methylation of histone H4 at the lysine 20 position (H4K20me); therefore, we also discuss an epigenetic landscape of 53BP1-positive DNA lesions.
- MeSH
- 53BP1 genetika metabolismus MeSH
- buněčné jádro genetika metabolismus MeSH
- fosforylace MeSH
- lidé MeSH
- oprava DNA * MeSH
- Check Tag
- lidé MeSH
- Publikační typ
- časopisecké články MeSH
- práce podpořená grantem MeSH
- přehledy MeSH
