The affiliation number 1, "Institute of Biophysics of the Czech Academy of Sciences, Královopolská 135, 612 65 Brno, Czech Republic" changed its zip code to 612 00 [...].
- Publikační typ
- tisková chyba MeSH
Gene therapy is a focus of interest in both human and veterinary medicine, especially in recent years due to the potential applications of CRISPR/Cas9 technology. Another relatively new approach is that of epigenetic therapy, which involves an intervention based on epigenetic marks, including DNA methylation, histone post-translational modifications, and post-transcription modifications of distinct RNAs. The epigenome results from enzymatic reactions, which regulate gene expression without altering DNA sequences. In contrast to conventional CRISP/Cas9 techniques, the recently established methodology of epigenetic editing mediated by the CRISPR/dCas9 system is designed to target specific genes without causing DNA breaks. Both natural epigenetic processes and epigenetic editing regulate gene expression and thereby contribute to maintaining the balance between physiological functions and pathophysiological states. From this perspective, knowledge of specific epigenetic marks has immense potential in both human and veterinary medicine. For instance, the use of epigenetic drugs (chemical compounds with therapeutic potential affecting the epigenome) seems to be promising for the treatment of cancer, metabolic, and infectious diseases. Also, there is evidence that an epigenetic diet (nutrition-like factors affecting epigenome) should be considered as part of a healthy lifestyle and could contribute to the prevention of pathophysiological processes. In summary, epigenetic-based approaches in human and veterinary medicine have increasing significance in targeting aberrant gene expression associated with various diseases. In this case, CRISPR/dCas9, epigenetic targeting, and some epigenetic nutrition factors could contribute to reversing an abnormal epigenetic landscape to a healthy physiological state.
- Publikační typ
- časopisecké články MeSH
- přehledy MeSH
BACKGROUND: Chemical modifications in mRNAs, tRNAs, rRNAs, and non-coding RNAs stabilize these nucleic acids and regulate their function. In addition to regulating the translation of genetic information from mRNA to proteins, it has been revealed that modifications in RNAs regulate repair processes in the genome. METHODS: Using local laser microirradiation, confocal microscopy, dot blots, and mass spectrometry we studied the role of N7-methylguanosine (m7G), which is co-transcriptionally installed in RNA. RESULTS: Here, we show that after UVC and UVA irradiation, the level of m7G RNA is increased initially in the cytoplasm, and after local laser microirradiation, m7G RNA is highly abundant in UVA-damaged chromatin. This process is poly(ADP-ribose) polymerase (PARP)-dependent, but not accompanied by changes in the level of m7G-writers, including methyltransferases RNMT, METTL1, and WBSCR22. We also observed that METTL1 deficiency does not affect the recruitment of m7G RNA to microirradiated chromatin. Analyzing the levels of mRNA, let-7e, and miR-203a in both the cytoplasm and the cell nucleus, we revealed that UVC irradiation changed the level of mRNA, and significantly increased the pool of both let-7e and miR-203a, which correlated with radiation-induced m7G RNA increase in the cytoplasm. CONCLUSIONS: Irradiation by UV light increases the m7G RNA pool in the cytoplasm and in the microirradiated genome. Thus, epigenetically modified RNAslikely contribute to DNA damage responses or m7G signals the presence of RNA damage.
- Publikační typ
- časopisecké články MeSH
FTO and ALKBH5 proteins are essential erasers of N6-adenosine methylation in RNA. We studied how levels of FTO and ALKBH5 proteins changed during mouse embryonic development, aging, cardiomyogenesis, and neuroectodermal differentiation. We observed that aging in male and female mice was associated with FTO up-regulation in mouse hearts, brains, lungs, and kidneys, while the ALKBH5 level remained stable. FTO and ALKBH5 proteins were up-regulated during experimentally induced cardiomyogenesis, but the level of ALKBH5 protein was not changed when neuroectodermal differentiation was induced. HDAC1 depletion in mouse ES cells caused FTO down-regulation. In these cells, mRNA, carrying information from genes that regulate histone signature, RNA processing, and cell differentiation, was characterized by a reduced level of N6-adenosine methylation in specific gene loci, primarily regulating cell differentiation into neuroectoderm. Together, when we compared both RNA demethylating proteins, the FTO protein level undergoes the most significant changes during cell differentiation and aging. Thus, we conclude that during aging and neuronal differentiation, m6A RNA demethylation is likely regulated by the FTO protein but not via the function of ALKBH5.
- MeSH
- adenosin metabolismus MeSH
- alfa-ketoglutarát-dependentní dioxygenasa, AlkB homolog 5 * genetika metabolismus MeSH
- buněčná diferenciace MeSH
- embryonální vývoj MeSH
- gen pro FTO * genetika metabolismus MeSH
- myši MeSH
- RNA metabolismus MeSH
- stárnutí genetika MeSH
- upregulace MeSH
- zvířata MeSH
- Check Tag
- mužské pohlaví MeSH
- myši MeSH
- ženské pohlaví MeSH
- zvířata MeSH
- Publikační typ
- časopisecké články MeSH
RNA modifications have been known for many years, but their function has not been fully elucidated yet. For instance, the regulatory role of acetylation on N4-cytidine (ac4C) in RNA can be explored not only in terms of RNA stability and mRNA translation but also in DNA repair. Here, we observe a high level of ac4C RNA at DNA lesions in interphase cells and irradiated cells in telophase. Ac4C RNA appears in the damaged genome from 2 to 45 min after microirradiation. However, RNA cytidine acetyltransferase NAT10 did not accumulate to damaged sites, and NAT10 depletion did not affect the pronounced recruitment of ac4C RNA to DNA lesions. This process was not dependent on the G1, S, and G2 cell cycle phases. In addition, we observed that the PARP inhibitor, olaparib, prevents the recruitment of ac4C RNA to damaged chromatin. Our data imply that the acetylation of N4-cytidine, especially in small RNAs, has an important role in mediating DNA damage repair. Ac4C RNA likely causes de-condensation of chromatin in the vicinity of DNA lesions, making it accessible for other DNA repair factors involved in the DNA damage response. Alternatively, RNA modifications, including ac4C, could be direct markers of damaged RNAs.
- MeSH
- acetylace MeSH
- chromatin MeSH
- cytidin * genetika metabolismus MeSH
- PARP inhibitory MeSH
- RNA * metabolismus MeSH
- Publikační typ
- časopisecké články MeSH
An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.
BACKGROUND: Variants of linker histone H1 are tissue-specific and are responsible for chromatin compaction accompanying cell differentiation, mitotic chromosome condensation, and apoptosis. Heterochromatinization, as the main feature of these processes, is also associated with pronounced trimethylation of histones H3 at the lysine 9 position (H3K9me3). METHODS: By confocal microscopy, we analyzed cell cycle-dependent levels and distribution of phosphorylated histone H1 (H1ph) and H3K9me3. By mass spectrometry, we studied post-translational modifications of linker histones. RESULTS: Phosphorylated histone H1, similarly to H3K9me3, has a comparable level in the G1, S, and G2 phases of the cell cycle. A high density of phosphorylated H1 was inside nucleoli of mouse embryonic stem cells (ESCs). H1ph was also abundant in prophase and prometaphase, while H1ph was absent in anaphase and telophase. H3K9me3 surrounded chromosomal DNA in telophase. This histone modification was barely detectable in the early phases of mitosis. Mass spectrometry revealed several ESC-specific phosphorylation sites of H1. HDAC1 depletion did not change H1 acetylation but potentiated phosphorylation of H1.2/H1.3 and H1.4 at serine 38 positions. CONCLUSIONS: Differences in the level and distribution of H1ph and H3K9me3 were revealed during mitotic phases. ESC-specific phosphorylation sites were identified in a linker histone.
- Publikační typ
- časopisecké články MeSH
RNA methylation, especially 6-methyladenosine (m6A)-modified RNAs, plays a specific role in DNA damage response (DDR). Here, we also observe that RNA modified at 8-methyladenosine (m8A) is recruited to UVA-damaged chromatin immediately after microirradiation. Interestingly, the level of m8A RNA at genomic lesions was reduced after inhibition of histone deacetylases and DNA methyltransferases. It appears in later phases of DNA damage response, accompanied by active DNA demethylation. Also, PARP inhibitor (PARPi), Olaparib, prevented adenosine methylation at microirradiated chromatin. PARPi abrogated not only m6A and m8A RNA positivity at genomic lesions, but also XRCC1, the factor of base excision repair (BER), did not recognize lesions in DNA. To this effect, Olaparib enhanced the genome-wide level of γH2AX. This histone modification interacted with m8A RNAs to a similar extent as m8A RNAs with DNA. Pronounced interaction properties we did not observe for m6A RNAs and DNA; however, m6A RNA interacted with XRCC1 with the highest efficiency, especially in microirradiated cells. Together, we show that the recruitment of m6A RNA and m8A RNA to DNA lesions is PARP dependent. We suggest that modified RNAs likely play a role in the BER mechanism accompanied by active DNA demethylation. In this process, γH2AX stabilizes m6A/m8A-positive RNA-DNA hybrid loops via its interaction with m8A RNAs. R-loops could represent basic three-stranded structures recognized by PARP-dependent non-canonical m6A/m8A-mediated DNA repair pathway.
Toxoplasmosis is a globally spread disease, affecting humans and many animal species, including birds. Antibodies to Toxoplasma gondii were detected in ostriches from South and North America, Africa and Asia. Except for one study from Spain, there is a lack of information about T. gondii seroprevalence in ostriches from Europe. For this reason, the aim of the study was to detect antibodies to T. gondii in farm-reared ostriches from the Czech Republic. Serum samples of 409 ostriches (Struthio camelus), collected at 9 farms were tested by Latex agglutination test. Antibodies to T. gondii were detected in 149 (36%) birds with a statistical difference for individual farms (8%-71%, p = 0.0121), and regions (8%-65%, p = 0.002). Seropositivity did not statistically differ (p > 0.05) in size of farms (50% and 35% on small and large farms, respectively), sex of birds (38% and 35% in males and females, respectively), season and year of collection. Tissue samples (brain, heart, and pectoral muscle) of 105 birds were also tested by PCR to detect T. gondii DNA. The parasite T. gondii was detected in the brain and heart of one seronegative ostrich (1%) from a small farm. Based on our results, we can assume that ostriches may present high risk of toxoplasmosis for humans through consumption of raw or undercooked ostrich meat and even seronegative individuals could harbor T. gondii in their tissues. To our knowledge, this is the first serological detection of T. gondii in ostriches in the Czech Republic, and the first PCR detection in Europe.
- MeSH
- farmy MeSH
- lidé MeSH
- protilátky protozoální krev MeSH
- protozoální DNA analýza MeSH
- rizikové faktory MeSH
- Struthioniformes * krev parazitologie MeSH
- Toxoplasma * genetika imunologie MeSH
- toxoplazmóza zvířat * krev diagnóza epidemiologie MeSH
- zvířata MeSH
- Check Tag
- lidé MeSH
- mužské pohlaví MeSH
- ženské pohlaví MeSH
- zvířata MeSH
- Publikační typ
- časopisecké články MeSH
- Geografické názvy
- Česká republika MeSH
Reports on non-invasive blood sampling are limited, and there are only a few studies on using kissing bugs (Reduviidae) and medicinal leeches (Hirudo medicinalis) for hematology and biochemistry testing in various zoo animal species. The aim of this study was to evaluate the usefulness of non-invasive blood sampling with medicinal leeches for arbovirus epidemiological investigations in various animal species from one zoo collection. Medicinal leeches were manually applied on 35 animals of 11 species. Control blood samples were obtained by venipuncture of the jugular vein. Antibodies to tick-borne encephalitic virus (TBEV) were detected by using the immunoenzymatic method or an immunofluorescent assay (IFAT), depending on the animal species. One of the 35 animals (2.9%) was seropositive (Ovis aries), whereas the rest of the samples were seronegative in both methods of sampling (non-invasive by leeches vs. invasive by venipuncture). Blood sampling using medicinal leeches showed promising results. It is likely a good alternative to other more complex and invasive methods, and it can provide significant advancement in blood sampling for preventive medicine and epidemiological studies in zoo animals.
- Publikační typ
- časopisecké články MeSH
