Confocal/fluorescence microscopy
Dotaz
Zobrazit nápovědu
BACKGROUND: Fast adaptation of glycolytic and mitochondrial energy pathways to changes in the tumour microenvironment is a hallmark of cancer. Purely glycolytic ρ0 tumour cells do not form primary tumours unless they acquire healthy mitochondria from their micro-environment. Here we explored the effects of severely compromised respiration on the metastatic capability of 4T1 mouse breast cancer cells. METHODS: 4T1 cell lines with different levels of respiratory capacity were generated; the Seahorse extracellular flux analyser was used to evaluate oxygen consumption rates, fluorescent confocal microscopy to assess the number of SYBR gold-stained mitochondrial DNA nucleoids, and the presence of the ATP5B protein in the cytoplasm and fluorescent in situ nuclear hybridization was used to establish ploidy. MinION nanopore RNA sequence analysis was used to compare mitochondrial DNA transcription between cell lines. Orthotopic injection was used to determine the ability of cells to metastasize to the lungs of female Balb/c mice. RESULTS: OXPHOS-deficient ATP5B-KO3.1 cells did not generate primary tumours. Severely OXPHOS compromised ρ0D5 cells generated both primary tumours and lung metastases. Cells generated from lung metastasis of both OXPHOS-competent and OXPHOS-compromised cells formed primary tumours but no metastases when re-injected into mice. OXPHOS-compromised cells significantly increased their mtDNA content, but this did not result in increased OXPHOS capacity, which was not due to decreased mtDNA transcription. Gene set enrichment analysis suggests that certain cells derived from lung metastases downregulate their epithelial-to-mesenchymal related pathways. CONCLUSION: In summary, OXPHOS is required for tumorigenesis in this orthotopic mouse breast cancer model but even very low levels of OXPHOS are sufficient to generate both primary tumours and lung metastases.
- Publikační typ
- časopisecké články MeSH
OBJECTIVE: The highly infiltrative growth of glioblastoma (GBM) makes distinction between the tumor and normal brain tissue challenging. Therefore, fluorescence-guided surgery is often used to improve visual identification of radiological tumor margins. The aim of this study was to evaluate the ability of recently developed molecularly targeted near-infrared (NIR) protease-activated probes to visualize GBM tissue and to compare the most promising candidate with the gold standard, 5-aminolevulinic acid (5-ALA). METHODS: Single-substrate probes 6QC-ICG and 6QC-Cy5 (cysteine cathepsin cleavable), double-substrate probes AG2-FNIR and AG2-Cy5 (cysteine cathepsin and caspase 3 cleavable), and 5-ALA were administered intravenously to mice with orthotopic tumors. Activation of the probes was also evaluated in cell cultures in vitro and in biopsy material from patients with GBM ex vivo. The tumor to normal brain tissue fluorescence ratio (TNR) was quantified in brain sections using preclinical and clinical visualization platforms, and in tissue homogenates and cell suspensions using spectrofluorimetry. Subcellular localization of the fluorophores was visualized by confocal microscopy. RESULTS: In vitro, the single-substrate probe 6QC-ICG was cleaved in glioma cells and macrophages, and the resulting fluorophore accumulated intracellularly. In experimental GBMs, both single- and double-substrate probes visualized tumor tissue, while in healthy brain tissue the signal was minimal. TNR was highest for 6QC-ICG and AG2-FNIR, but the signal intensity was higher for 6QC-ICG. Using xenograft and syngeneic mouse models, as well as human GBM biopsy material ex vivo, the authors confirmed the ability of 6QC-ICG to specifically visualize the glioma tissue using preclinical and clinical visualization platforms. Finally, a comparison with 5-ALA in animals coadministered with both compounds revealed a higher TNR for 6QC-ICG in experimental GBMs. CONCLUSIONS: The cysteine cathepsin-cleavable probe 6QC-ICG is activated by glioma cells and tumor-associated macrophages, leading to a high contrast between tumor and nontumorous brain tissue that is superior to that of the current standard, 5-ALA. In addition to a well-defined mechanism of action, protease-activated probes that use NIR fluorophores (e.g., indocyanine green) have the advantage of low absorption and scattering of the NIR light and lower tissue autofluorescence. These results suggest that 6QC-ICG has the potential to become the targeted agent in intraoperative detection of GBM tissue using fluorescence imaging.
- MeSH
- fluorescenční barviva MeSH
- glioblastom * diagnostické zobrazování patologie MeSH
- kyselina aminolevulová * MeSH
- lidé MeSH
- molekulární sondy MeSH
- myši MeSH
- nádorové buněčné linie MeSH
- nádory mozku * diagnostické zobrazování patologie MeSH
- optické zobrazování metody MeSH
- proteasy metabolismus MeSH
- zvířata MeSH
- Check Tag
- lidé MeSH
- myši MeSH
- zvířata MeSH
- Publikační typ
- časopisecké články MeSH
- srovnávací studie MeSH
BACKGROUND: Pancreatic ductal adenocarcinoma (PDAC) has been associated with the host dysmetabolism of branched-chain amino acids (BCAAs), however, the implications for the role of BCAA metabolism in PDAC development or progression are not clear. The mitochondrial catabolism of valine, leucine, and isoleucine is a multistep process leading to the production of short-chain R-CoA species. They can be subsequently exported from mitochondria as short-chain carnitines (SC-CARs), utilized in anabolic pathways, or released from the cells. METHODS: We examined the specificities of BCAA catabolism and cellular adaptation strategies to BCAA starvation in PDAC cells in vitro. We used metabolomics and lipidomics to quantify major metabolic changes in response to BCAA withdrawal. Using confocal microscopy and flow cytometry we quantified the fluorescence of BODIPY probe and the level of lipid droplets (LDs). We used BODIPY-conjugated palmitate to evaluate transport of fatty acids (FAs) into mitochondria. Also, we have developed a protocol for quantification of SC-CARs, BCAA-derived metabolites. RESULTS: Using metabolic profiling, we found that BCAA starvation leads to massive triglyceride (TG) synthesis and LD accumulation. This was associated with the suppression of activated FA transport into the mitochondrial matrix. The suppression of FA import into mitochondria was rescued with the inhibitor of the acetyl-CoA carboxylase (ACC) and the activator of AMP kinase (AMPK), which both regulate carnitine palmitoyltransferase 1A (CPT1) activation status. CONCLUSIONS: Our data suggest that BCAA catabolism is required for the import of long chain carnitines (LC-CARs) into mitochondria, whereas the disruption of this link results in the redirection of activated FAs into TG synthesis and its deposition into LDs. We propose that this mechanism protects cells against mitochondrial overload with LC-CARs and it might be part of the universal reaction to amino acid perturbations during cancer growth, regulating FA handling and storage.
- Publikační typ
- časopisecké články MeSH
Avian (ortho)reovirus (ARV), which belongs to Reoviridae family, is a major domestic fowl pathogen and is the causative agent of viral tenosynovitis and chronic respiratory disease in chicken. ARV replicates within cytoplasmic inclusions, so-called viral factories, that form by phase separation and thus belong to a wider class of biological condensates. Here, we evaluate different optical imaging methods that have been developed or adapted to follow formation, fluidity and composition of viral factories and compare them with the complementary structural information obtained by well-established transmission electron microscopy and electron tomography. The molecular and cellular biology aspects for setting up and following virus infection in cells by imaging are described first. We then demonstrate that a wide-field version of fluorescence recovery after photobleaching is an effective tool to measure fluidity of mobile viral factories. A new technique, holotomographic phase microscopy, is then used for imaging of viral factory formation in live cells in three dimensions. Confocal Raman microscopy of infected cells provides "chemical" contrast for label-free segmentation of images and addresses important questions about biomolecular concentrations within viral factories and other biological condensates. Optical imaging is complemented by electron microscopy and tomography which supply higher resolution structural detail, including visualization of individual virions within the three-dimensional cellular context.
Lipid droplets (LD) are important regulators of lipid metabolism and are implicated in several diseases. However, the mechanisms underlying the roles of LD in cell pathophysiology remain elusive. Hence, new approaches that enable better characterization of LD are essential. This study establishes that Laurdan, a widely used fluorescent probe, can be used to label, quantify, and characterize changes in cell LD properties. Using lipid mixtures containing artificial LD we show that Laurdan GP depends on LD composition. Accordingly, enrichment in cholesterol esters (CE) shifts Laurdan GP from ∼0.60 to ∼0.70. Moreover, live-cell confocal microscopy shows that cells present multiple LD populations with distinctive biophysical features. The hydrophobicity and fraction of each LD population are cell type dependent and change differently in response to nutrient imbalance, cell density, and upon inhibition of LD biogenesis. The results show that cellular stress caused by increased cell density and nutrient overload increased the number of LD and their hydrophobicity and contributed to the formation of LD with very high GP values, likely enriched in CE. In contrast, nutrient deprivation was accompanied by decreased LD hydrophobicity and alterations in cell plasma membrane properties. In addition, we show that cancer cells present highly hydrophobic LD, compatible with a CE enrichment of these organelles. The distinct biophysical properties of LD contribute to the diversity of these organelles, suggesting that the specific alterations in their properties might be one of the mechanisms triggering LD pathophysiological actions and/or be related to the different mechanisms underlying LD metabolism.
Reactive oxygen species play a key role in cellular homeostasis and redox signaling at physiological levels, where excessive production affects the function and integrity of macromolecules, specifically proteins. Therefore, it is important to define radical-mediated proteotoxic stress in macrophages and identify target protein to prevent tissue dysfunction. A well employed, THP-1 cell line was utilized as in vitro model to study immune response and herein we employ immuno-spin trapping technique to investigate radical-mediated protein oxidation in macrophages. Hydroxyl radical formation along macrophage differentiation was confirmed by electron paramagnetic resonance along with confocal laser scanning microscopy using hydroxyphenyl fluorescein. Lipid peroxidation product, malondialdehyde, generated under experimental conditions as detected using swallow-tailed perylene derivative fluorescence observed by confocal laser scanning microscopy and high-performance liquid chromatography, respectively. The results obtained from this study warrant further corroboration and study of specific proteins involved in the macrophage activation and their role in inflammations.
Owing to their complicated pathophysiology, the treatment of skin diseases necessitates a complex approach. Conventional treatment using topical corticosteroids often results in low effectiveness and the incidence of local or even systemic side effects. Nanoformulation of potent anti-inflammatory drugs has been selected as an optimal strategy for enhanced topical delivery of corticosteroids. In order to assess the efficiency of various nanoformulations, we formulated hydrocortisone (HC) and hydrocortisone-17-butyrate (HCB) into three different systems: lipid nanocapsules (LNC), polymeric nanoparticles (PNP), and ethosomes (ETZ). The systems were characterized using dynamic light scattering for their particle size and uniformity and the morphology of nanoparticles was observed by transmission electron microscopy. The nanosystems were tested using ex vivo full thickness porcine and human skin for the delivery of HC and HCB. The skin penetration was observed by confocal microscopy of fluorescently labelled nanosystems. ETZ were proposed as the most effective delivery system for both transdermal and dermal drug targeting but were also found to have a profound effect on the skin barrier with limited restoration. LNC and PNP were found to have significant effects in the dermal delivery of the actives with only minimal transdermal penetration, especially in case of HCB administration.
- Publikační typ
- časopisecké články MeSH
The complexity of drug delivery mechanisms calls for the development of new transport system designs. Here, we report a robust synthetic procedure toward stable glycodendrimer (glyco-DDM) series bearing glucose, galactose, and oligo(ethylene glycol)-modified galactose peripheral units. In vitro cytotoxicity assays showed exceptional biocompatibility of the glyco-DDMs. To demonstrate applicability in drug delivery, the anticancer agent doxorubicin (DOX) was encapsulated in the glyco-DDM structure. The anticancer activity of the resulting glyco-DDM/DOX complexes was evaluated on the noncancerous (BJ) and cancerous (MCF-7 and A2780) cell lines, revealing their promising generation- and concentration-dependent effect. The glyco-DDM/DOX complexes show gradual and pH-dependent DOX release profiles. Fluorescence spectra elucidated the encapsulation process. Confocal fluorescence microscopy demonstrated preferential cancer cell internalization of the glyco-DDM/DOX complexes. The conclusions were supported by computer modeling. Overall, our results are consistent with the assumption that novel glyco-DDMs and their drug complexes are very promising in drug delivery and related applications.
- MeSH
- doxorubicin chemie farmakologie MeSH
- lékové transportní systémy metody MeSH
- lidé MeSH
- nádorové buněčné linie MeSH
- nádory vaječníků * MeSH
- nosiče léků chemie MeSH
- polyethylenglykoly chemie MeSH
- protinádorové látky * farmakologie MeSH
- silany MeSH
- uvolňování léčiv MeSH
- Check Tag
- lidé MeSH
- ženské pohlaví MeSH
- Publikační typ
- časopisecké články MeSH
- práce podpořená grantem MeSH
An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.
Vagal afferents regulate numerous physiological functions including arterial blood pressure, heart rate, breathing, and nociception. Cell bodies of vagal afferents reside in the inferior vagal (nodose) ganglia and their stimulation by various means is being considered as a way to regulate cardiorespiratory responses and control pain sensations. Stimulation of the nodose by exposure to infrared light is recently being considered as a precise way to elicit responses. These responses would likely involve the activity of temperature-sensitive membrane-bound channels. While papers have been published to track the expression of these transient receptor potential ion channels (TRPs), further studies are warranted to determine the in situ expression of the endogenous TRP proteins in the nodose ganglia to fully understand their pattern of expression, subcellular locations, and functions in this animal model. TRP ion channels are a superfamily of Na+ /Ca2+ -channels whose members are temperature- and/or mechano-sensitive and therefore represent a potential set of proteins that will be activated directly or indirectly by infrared light. Here, we report the spatial localization of six TRP channels, TRPV1, TRPV4, TRPM3, TRPM8, TRPA1, and TRPC1, from nodose ganglia taken from juvenile male Sprague-Dawley rats. The channels were detected using immunohistology with fluorescent tags on cryosections and imaged using confocal microscopy. All six TRP channels were detected with different levels of intensity in neuronal cell bodies and some were also detected in axonal fibers and blood vessels. The TRP receptors differed in their prevalence, in their patterns of expression, and in subcellular expression/localization. More specifically, TRPV1, TRPV4, TRPA1, TRPM8, TRPC1, and TRPM3 were found in vagal afferent cell bodies with a wide range of immunostaining intensity from neuron to neuron. Immunostaining for TRPV1, TRPV4, and TRPA1 appeared as fine particles scattered throughout the cytoplasm of the cell body. Intense TRPV1 immunostaining was also evident in a subset of axonal fibers. TRPM8 and TRPC1 were expressed in courser particles suggesting different subcellular compartments than for TRPV1. The localization of TRPM3 differed markedly from the other TRP channels with an immunostaining pattern that was localized to the periphery of a subset of cell bodies, whereas a scattering or no immunostaining was detected within the bulk of the cytoplasm. TRPV4 and TRPC1 were also expressed on the walls of blood vessels. The finding that all six TRP channels (representing four subfamilies) were present in the nodose ganglia provides the basis for studies designed to understand the roles of these channels in sensory transmission within vagal afferent fibers and in the responses elicited by exposure of nodose ganglia to infrared light and other stimuli. Depending on the location and functionality of the TRP channels, they may regulate the flux of Na+ /Ca2+ -across the membranes of cell bodies and axons of sensory afferents, efferent (motor) fibers coursing through the ganglia, and in vascular smooth muscle.
- MeSH
- ganglion inferius metabolismus MeSH
- kationtové kanály TRP * metabolismus MeSH
- kationtové kanály TRPM * metabolismus MeSH
- kationtové kanály TRPV MeSH
- krysa rodu rattus MeSH
- nervus vagus metabolismus MeSH
- potkani Sprague-Dawley MeSH
- zvířata MeSH
- Check Tag
- krysa rodu rattus MeSH
- mužské pohlaví MeSH
- zvířata MeSH
- Publikační typ
- časopisecké články MeSH
