Závěrečná zpráva o řešení grantu Agentury pro zdravotnický výzkum MZ ČR
nestr.
Chimeric antigen receptor (CAR) T-cell is a cutting edge technology for targeted cell therapy of oncologic diseases. Promising clinical results were reported for hematological malignancies, but the results in solid tumors are not that encouranging yet. Here we propose to validate protocols for the production of CAR T-cells against solid tumor antigens under cGMP rules. We will focus mainly on target antigens GD2, PSMA, and PSCA. Standard operation protocols and analytical certificates will be presented to the State Institute for Drug Control for their approval. The consortium of three prominent research facilities will participate on this project: (i) International Clinical Research Center of St. Anne's University Hospital Brno (FNUSA-ICRC), (ii) Centre for Biomedical Image Analysis at Masaryk University Brno (MU-CBIA), and (iii) Institute of Hematology and Blood Transfusion in Prague (UHKT). Our main aim is to establish production of CAR T-cells for anti-solid tumor therapy which can be translated into clinical applications.
T lymfocyty s chimerickým antigenním receptorem (CAR) představují nejmodernější technologii v cílené buněčné terapii onkologických onemocnění. Slibné klinické výsledky byly publikovány v léčbě hemato-onkologických malignit, avšak výsledky v léčbě solidních nádorů nejsou zatím tak povzbudivé. V navrhovaném projektu se budeme věnovat validaci protokolů pro výrobu CAR T-lymfocytů proti solidním nádorům v režimu správné laboratorní praxe. Zaměříme se hlavně na cílové antigeny GD2, PSMA a PSCA. Standardní operační protokoly a analytické certifikáty budou předány Státnímu ústavu pro kontrolu léčiv ke schválení. Na projektu budou spolupracovat tři špičková výzkumná pracoviště: (i) Mezinárodní centrum klinického výzkumu Fakultní nemocnice u sv. Anny v Brně, (ii) Centrum analýzy biomedicínského obrazu na Masarykově Univerzitě v Brně (MU-CBIA) a (iii) Ústav hematologie a krevní transfuze v Praze (ÚHKT). Naším hlavním cílem je zavést technologii výroby CAR T-lymfocytů pro cílenou buněčnou terapii solidních tumorů a tím umožnit přenos do klinické praxe.
- Klíčová slova
- advanced therapy medicinal products, solid tumors, T-lymfocyty, T-cells, solidní tumory, Chimerický antigenní receptor, Správná laboratorní praxe, Přípravky moderní terapie, Chimeric antigen receptor, Current Good Manufacturing Practice,
- NLK Publikační typ
- závěrečné zprávy o řešení grantu AZV MZ ČR
Aim: Human induced pluripotent stem cells (iPSCs) are inefficiently derived from somatic cells by overexpression of defined transcription factors. Overexpression of H2A histone variant macroH2A1.1, but not macroH2A1.2, leads to increased iPSC reprogramming by unclear mechanisms. Materials & methods: Cleavage under targets and tagmentation (CUT&Tag) allows robust epigenomic profiling of a low cell number. We performed an integrative CUT&Tag-RNA-Seq analysis of macroH2A1-dependent orchestration of iPSCs reprogramming using human endothelial cells. Results: We demonstrate wider genome occupancy, predicted transcription factors binding, and gene expression regulated by macroH2A1.1 during reprogramming, compared to macroH2A1.2. MacroH2A1.1, previously associated with neurodegenerative pathologies, specifically activated ectoderm/neural processes. Conclusion: CUT&Tag and RNA-Seq data integration is a powerful tool to investigate the epigenetic mechanisms occurring during cell reprogramming.
- MeSH
- endoteliální buňky metabolismus MeSH
- histony * metabolismus MeSH
- indukované pluripotentní kmenové buňky * metabolismus MeSH
- lidé MeSH
- přeprogramování buněk genetika MeSH
- sekvenování transkriptomu MeSH
- transkripční faktory genetika MeSH
- Check Tag
- lidé MeSH
- Publikační typ
- časopisecké články MeSH
- práce podpořená grantem MeSH
BACKGROUND: Human embryonic stem cells (hESCs) have the unique ability to differentiate into any cell type in the human body and to proliferate indefinitely. Cell therapies involving hESC have shown very promising results for the treatment of certain diseases and confirmed the safety of hESC-derived cells for humans. They are used in cell therapy, mainly in targeted therapy of diseases that are currently incurable. OBJECTIVES: The aim of this study was the derivation of clinical-grade hESCs usable in drug development, non-native medicine and cell therapy. MATERIAL AND METHODS: Embryos were thawed, cultivated to the blastocyst stage if necessary, and assisted hatching was subsequently performed. Embryoblasts were mechanically isolated using narrow needles. Each line was kept as a separate batch. The derived hESCs were cultured under hypoxic culture conditions (5% O2, 5% CO2, 37°C) in a NutriStem® hPSC XF Medium with a daily medium change. RESULTS: From January 2018 to July 2020, 138 selected clients were asked for consent to donate embryos, of whom 52 did not respond, 19 terminated the storage of their embryos and 29 extended the storage. Only 38 clients (27.5%) agreed to donate embryos for the derivation of hESCs. At the same time, personal communication with clients took place and another 17 embryo donors were recruited. A total of 160 embryos from 55 donors aged 26-42 years were collected. The embryos were frozen at the blastocyst (33.1%) or morula (46.3%) stage. After the preparation of 64 embryos, embryoblasts were isolated and cultured. Finally, 7 hESC lines were obtained, 4 research-grade and 3 clinical-grade, the first in the Czech Republic. CONCLUSIONS: We established a current good manufacturing practice (cGMP)-defined xeno-free and feeder-free system for the derivation, culture and banking of clinical-grade hESC lines that are suitable for preclinical and clinical trials. The quality control testing with criteria concerning sterility, safety and characterization according to cGMP ensured the clinical-grade quality of hESC lines.
- MeSH
- buněčné linie MeSH
- embryo savčí MeSH
- embryonální kmenové buňky * MeSH
- kvalita života * MeSH
- lidé MeSH
- Check Tag
- lidé MeSH
- Publikační typ
- časopisecké články MeSH
- Geografické názvy
- Česká republika MeSH
An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.
Human embryonic stem cells (hESCs) have unique abilities that enable their use in cell therapy, disease modeling, and drug development. Their derivation is usually performed using a feeder layer, which is undefined and can potentially cause a contamination by xeno components, therefore there is a tendency to replace feeders with xeno-free defined substrates in recent years. Three hESC lines were successfully derived on the vitronectin with a truncated N-terminus (VTN-N) in combination with E-cadherin in xeno-free conditions for the first time, and their undifferentiated state, hESC morphology, and standard karyotypes together with their potential to differentiate into three germ layers were confirmed. These results support the conclusion that the VTN-N/E-cadherin is a suitable substrate for the xeno-free derivation of hESCs and can be used for the derivation of hESCs according to good manufacturing practices.
- MeSH
- buněčná a tkáňová terapie MeSH
- kadheriny genetika MeSH
- lidé MeSH
- lidské embryonální kmenové buňky * MeSH
- obchod MeSH
- vitronektin MeSH
- Check Tag
- lidé MeSH
- Publikační typ
- časopisecké články MeSH
- práce podpořená grantem MeSH
Human embryonic stem cells (hESCs) are increasingly used in clinical trials as they can change the outcome of treatment for many human diseases. They are used as a starting material for further differentiation into specific cell types and to achieve the desirable result of the cell therapy; thus, the quality of hESCs has to be taken into account. Therefore, current good manufacturing practice (cGMP) has to be implemented in the transport of embryos, derivation of inner cell mass to xeno-free, feeder-free and defined hESC culture, and cell freezing. The in-depth characterization of hESC lines focused on safety, pluripotency, differentiation potential and genetic background has to complement this process. In this paper, we show the derivation of three clinical-grade hESC lines, MUCG01, MUCG02, and MUCG03, following these criteria. We developed and validated the system for the manufacture of xeno-free and feeder-free clinical-grade hESC lines that present high-quality starting material suitable for cell therapy according to cGMP.
Závěrečná zpráva o řešení grantu Agentury pro zdravotnický výzkum MZ ČR
nestr.
Because of their unprecedented self-renewing and differentiation capacity, pluripotent stem cells (PSCs), both embryonic and induced, represent an unmatched cell source for advanced cell-based therapeutic scenarios and products, which are currently being devised and clinically tested at many respected institutions around globe. The key element in moving the Advanced Therapy Medicinal Products into clinical practice is their adherence to regulations ensuring ethical standards, safety, pharmaceutical quality, and efficacy. In the Czech Republic, clinically applicable lines of PSCs have not yet been produced and/or manipulated that imposes a major barrier to any clinical development. Therefore, here we propose to abrogate this hurdle by creating new platform, which will involve 1) set of clinical grade lines of embryonic SCs produced from ethically acceptable discarded human embryos under Good Manufacturing Practice (GMP)-compliant principles, and also 2) all corresponding manufacturing and regulatory elements such as Standard Operating Procedures (SOPs) and Quality Control procedures.
Pluripotentní kmenové buňky (PSC), embryonální i indukované, mají neomezenou reprodukční a diferenciační kapacitu a představují proto téměř dokonalý zdroj pro přípravu léčivých přípravků pro pokročilé terapie, které jsou v současnosti vyvíjeny a klinicky testovány na mnoha významných institucích na celém světě. Jedním z prvků, které jsou klíčové pro posun tohoto druhu léčivých přípravků do kliniky, je jejich soulad s regulačními požadavky, zajišťujícími etický původ, bezpečnost, farmakologickou kvalitu a účinnost. V České republice dosud žádné takové klinicky aplikovatelné PSC nebyly vytvořeny, což je zásadní bariéra pro jakýkoli další vývoj směrem k jejich využití v klinické medicíně. V tomto projektu proto navrhujeme odstranit toto omezení vybudováním nové platformy, která bude zahrnovat 1) set linií lidských embryonálních kmenových buněk derivovaných z eticky přijatelných vyřazených embryí za respektování principů dobré výrobní praxe (GMP) a také 2) všechny související výrobní a regulační prvky, jako jsou zejména standardní operační postupy (SOP) a postupy pro hodnocení kvality.
DNA damage repair (DDR) is a safeguard for genome integrity maintenance. Increasing DDR efficiency could increase the yield of induced pluripotent stem cells (iPSC) upon reprogramming from somatic cells. The epigenetic mechanisms governing DDR during iPSC reprogramming are not completely understood. Our goal was to evaluate the splicing isoforms of histone variant macroH2A1, macroH2A1.1, and macroH2A1.2, as potential regulators of DDR during iPSC reprogramming. GFP-Trap one-step isolation of mtagGFP-macroH2A1.1 or mtagGFP-macroH2A1.2 fusion proteins from overexpressing human cell lines, followed by liquid chromatography-tandem mass spectrometry analysis, uncovered macroH2A1.1 exclusive interaction with Poly-ADP Ribose Polymerase 1 (PARP1) and X-ray cross-complementing protein 1 (XRCC1). MacroH2A1.1 overexpression in U2OS-GFP reporter cells enhanced specifically nonhomologous end joining (NHEJ) repair pathway, while macroH2A1.1 knock-out (KO) mice showed an impaired DDR capacity. The exclusive interaction of macroH2A1.1, but not macroH2A1.2, with PARP1/XRCC1, was confirmed in human umbilical vein endothelial cells (HUVEC) undergoing reprogramming into iPSC through episomal vectors. In HUVEC, macroH2A1.1 overexpression activated transcriptional programs that enhanced DDR and reprogramming. Consistently, macroH2A1.1 but not macroH2A1.2 overexpression improved iPSC reprogramming. We propose the macroH2A1 splicing isoform macroH2A1.1 as a promising epigenetic target to improve iPSC genome stability and therapeutic potential.
- MeSH
- DNA MeSH
- endoteliální buňky metabolismus MeSH
- histony * metabolismus MeSH
- indukované pluripotentní kmenové buňky * metabolismus MeSH
- lidé MeSH
- myši MeSH
- oprava DNA MeSH
- protein XRCC1 genetika metabolismus MeSH
- zvířata MeSH
- Check Tag
- lidé MeSH
- myši MeSH
- zvířata MeSH
- Publikační typ
- časopisecké články MeSH
COVID-19 is caused by the SARS-CoV-2 virus and has spread globally in 2020. Cellular immunity may serve as an important functional marker of the disease, especially in the asymptomatic cases. Blood samples were collected from 46 convalescent donors with a history of COVID-19 and 38 control donors. Quantification of the T-cell response upon contact with SARS-CoV-2 proteins in vitro was based on IFN-γ. Significantly higher numbers of activated cells were measured in patients who underwent COVID-19. Anti-SARS-CoV-2 T cells were detected weeks after the active virus disappeared from the organism. Repeated sample collection after five months proved that the T-cell activation was weaker in time in 79 % of the patients. In the majority of cases, the CD4+ helper T-cell subpopulation was responsible for the immune reaction. Moreover, different viral proteins triggered activation in CD4+ helper and in CD8+ cytotoxic T cells. Together, these findings suggest that the T-cell activation level identifies the individuals who underwent COVID-19 and may become a diagnostic tool for the disease.
- MeSH
- aktivace lymfocytů MeSH
- COVID-19 * MeSH
- lidé MeSH
- protilátky virové MeSH
- SARS-CoV-2 MeSH
- T-lymfocyty MeSH
- Check Tag
- lidé MeSH
- Publikační typ
- časopisecké články MeSH
Significance: Since their discovery, induced pluripotent stem cells (iPSCs) had generated considerable interest in the scientific community for their great potential in regenerative medicine, disease modeling, and cell-based therapeutic approach, due to their unique characteristics of self-renewal and pluripotency. Recent Advances: Technological advances in iPSC genome-wide epigenetic profiling led to the elucidation of the epigenetic control of cellular identity during nuclear reprogramming. Moreover, iPSC physiology and metabolism are tightly regulated by oxidation-reduction events that mainly occur during the respiratory chain. In theory, iPSC-derived differentiated cells would be ideal for stem cell transplantation as autologous cells from donors, as the risks of rejection are minimal. Critical Issues: However, iPSCs experience high oxidative stress that, in turn, confers a high risk of increased genomic instability, which is most often linked to DNA repair deficiencies. Genomic instability has to be assessed before iPSCs can be used in therapeutic designs. Future Directions: This review will particularly focus on the links between redox balance and epigenetic modifications-in particular based on the histone variant macroH2A1-that determine DNA damage response in iPSCs and derived differentiated cells, and that might be exploited to decrease the teratogenic potential on iPSC transplantation. Antioxid. Redox Signal. 34, 335-349.
- MeSH
- buněčná diferenciace * genetika MeSH
- buněčná sebeobnova MeSH
- epigeneze genetická * MeSH
- indukované pluripotentní kmenové buňky cytologie metabolismus MeSH
- lidé MeSH
- metylace DNA MeSH
- mitochondrie genetika metabolismus MeSH
- nádorová transformace buněk genetika metabolismus MeSH
- nestabilita genomu MeSH
- oxidace-redukce * MeSH
- oxidační stres MeSH
- oxidativní fosforylace MeSH
- pluripotentní kmenové buňky cytologie metabolismus MeSH
- přeprogramování buněk genetika MeSH
- regenerativní lékařství MeSH
- transplantace kmenových buněk MeSH
- Check Tag
- lidé MeSH
- Publikační typ
- časopisecké články MeSH
- práce podpořená grantem MeSH
