Proteomics is nowadays increasingly becoming part of the routine clinical practice of diagnostic laboratories, especially due to the advent of advanced mass spectrometry techniques. This review focuses on the application of proteomic analysis in the identification of pathological conditions in a hospital setting, with a particular focus on the analysis of protein biomarkers. In particular, the main purpose of the review is to highlight the challenges associated with the identification of specific disease-causing proteins, given their complex nature and the variety of posttranslational modifications (PTMs) they can undergo. PTMs, such as phosphorylation and glycosylation, play critical roles in protein function but can also lead to diseases if dysregulated. Proteomics plays an important role especially in various medical fields ranging from cardiology, internal medicine to hemato-oncology emphasizing the interdisciplinary nature of this field. Traditional methods such as electrophoretic or immunochemical methods have been mainstay in protein detection; however, these techniques are limited in terms of specificity and sensitivity. Examples include the diagnosis of multiple myeloma and the detection of its specific protein or amyloidosis, which relies heavily on these conventional methods, which sometimes lead to false positives or inadequate disease monitoring. Mass spectrometry in this respect emerges as a superior alternative, providing high sensitivity and specificity in the detection and quantification of specific protein sequences. This technique is particularly beneficial for monitoring minimal residual disease (MRD) in the diagnosis of multiple myeloma where traditional methods fall short. Furthermore mass spectrometry can provide precise typing of amyloid proteins, which is crucial for the appropriate treatment of amyloidosis. This review summarizes the opportunities for proteomic determination using mass spectrometry between 2012 and 2024, highlighting the transformative potential of mass spectrometry in clinical proteomics and encouraging its wider use in diagnostic laboratories.
- MeSH
- Amyloidosis * diagnosis MeSH
- Biomarkers analysis MeSH
- Mass Spectrometry * methods MeSH
- Humans MeSH
- Multiple Myeloma * diagnosis MeSH
- Protein Processing, Post-Translational MeSH
- Proteomics * methods MeSH
- Check Tag
- Humans MeSH
- Publication type
- Journal Article MeSH
- Review MeSH
Histones are positively charged proteins found in the chromatin of eukaryotic cells. They regulate gene expression and are required for the organization and packaging of DNA within the nucleus. Histones are extremely conserved, allowing for transcription, replication, and repair. This review delves into their complex structure and function in DNA assembly, their role in nucleosome assembly, and the higher-order chromatin structures they generate. We look at the five different types of histone proteins: H1, H2A, H2B, H3, H4, and their variations. These histones bind with DNA to produce nucleosomes, the basic units of chromatin that are essential for compacting DNA and controlling its accessibility. Their dynamic control of chromatin accessibility has important implications for genomic stability and cellular activities. We elucidate regulatory mechanisms in both normal and pathological situations by investigating their structural features, diverse interaction mechanisms, and chromatin impact. In addition, we discuss the functions of histone post-translational modifications (PTMs) and their significance in various disorders. These alterations, which include methylation, acetylation, phosphorylation, and ubiquitination, are crucial in regulating histone function and chromatin dynamics. We specifically describe and explore the role of changed histones in the evolution of cancer, neurological disorders, sepsis, autoimmune illnesses, and inflammatory conditions. This comprehensive review emphasizes histone's critical role in genomic integrity and their potential as therapeutic targets in various diseases.
- MeSH
- Chromatin metabolism genetics chemistry MeSH
- DNA * metabolism chemistry MeSH
- Genome MeSH
- Histones * metabolism chemistry genetics MeSH
- Humans MeSH
- Neoplasms genetics metabolism MeSH
- Protein Processing, Post-Translational MeSH
- Animals MeSH
- Check Tag
- Humans MeSH
- Animals MeSH
- Publication type
- Journal Article MeSH
- Review MeSH
Spermatogenesis starts with the onset of puberty within the seminiferous epithelium of the testes. It is a complex process under intricate control of the endocrine system. Physiological regulations by steroid hormones in general and by estrogens in particular are due to their chemical nature prone to be disrupted by exogenous factors acting as endocrine disruptors (EDs). 17α-Ethynylestradiol (EE2) is an environmental pollutant with a confirmed ED activity and a well-known effect on spermatogenesis and chromatin remodeling in haploid germ cells. The aim of our study was to assess possible effects of two doses (2.5ng/ml; 2.5 μg/ml) of EE2 on both histone-to-protamine exchange and epigenetic profiles during spermatogenesis performing a multi/transgenerational study in mice. Our results demonstrated an impaired histone-to-protamine exchange with a significantly higher histone retention in sperm nuclei of exposed animals, when this process was accompanied by the changes of histone post-translational modifications (PTMs) abundancies with a prominent effect on H3K9Ac and partial changes in protamine 1 promoter methylation status. Furthermore, individual changes in molecular phenotypes were partially transmitted to subsequent generations, when no direct trans-generational effect was observed. Finally, the uncovered specific localization of the histone retention in sperm nuclei and their specific PTMs profile after EE2 exposure may indicate an estrogenic effect on sperm motility and early embryonic development via epigenetic mechanisms.
- MeSH
- Endocrine Disruptors pharmacology toxicity MeSH
- Epigenesis, Genetic * drug effects MeSH
- Ethinyl Estradiol * pharmacology MeSH
- Histones * metabolism MeSH
- Mice MeSH
- Protein Processing, Post-Translational drug effects MeSH
- Protamines * metabolism genetics MeSH
- Spermatogenesis * drug effects genetics MeSH
- Spermatozoa drug effects metabolism MeSH
- Testis * drug effects metabolism MeSH
- Animals MeSH
- Check Tag
- Male MeSH
- Mice MeSH
- Female MeSH
- Animals MeSH
- Publication type
- Journal Article MeSH
BACKGROUND: Obesity is a major health burden. Preadipocytes proliferate and differentiate in mature adipocytes in the adipogenic process, which could be a potential therapeutic approach for obesity. Deficiency of SIRT6, a stress-responsive protein deacetylase and mono-ADP ribosyltransferase enzyme, blocks adipogenesis. Mutants of SIRT6 (N308K/A313S) were recently linked to the in the long lifespan Ashkenazi Jews. In this study, we aimed to clarify how these new centenarian-associated SIRT6 genetic variants affect adipogenesis at the transcriptional and epigenetic level. METHODS: We analyzed the role of SIRT6 wild-type (WT) or SIRT6 centenarian-associated mutant (N308K/A313S) overexpression in adipogenesis, by creating stably transduced preadipocyte cell lines using lentivirus on the 3T3-L1 model. Histone post-translational modifications (PTM: acetylation, methylation) and transcriptomic changes were analyzed by mass spectrometry (LC-MS/MS) and RNA-Seq, respectively, in 3T3-L1 adipocytes. In addition, the adipogenic process and related signaling pathways were investigated by bioinformatics and biochemical approaches. RESULTS: Overexpression of centenarian-associated SIRT6 mutant increased adipogenic differentiation to a similar extent compared to the WT form. However, it triggered distinct histone PTM profiles in mature adipocytes, with significantly higher acetylation levels, and activated divergent transcriptional programs, including those dependent on signaling related to the sympathetic innervation and to PI3K pathway. 3T3-L1 mature adipocytes overexpressing SIRT6 N308K/A313S displayed increased insulin sensitivity in a neuropeptide Y (NPY)-dependent manner. CONCLUSIONS: SIRT6 N308K/A313S overexpression in mature adipocytes ameliorated glucose sensitivity and impacted sympathetic innervation signaling. These findings highlight the importance of targeting SIRT6 enzymatic activities to regulate the co-morbidities associated with obesity.
- MeSH
- Adipogenesis * genetics MeSH
- 3T3-L1 Cells * MeSH
- Epigenesis, Genetic * genetics MeSH
- Histones metabolism genetics MeSH
- Humans MeSH
- Mutation MeSH
- Mice MeSH
- Obesity genetics metabolism MeSH
- Protein Processing, Post-Translational genetics MeSH
- Sirtuins * genetics metabolism MeSH
- Adipocytes * metabolism MeSH
- Animals MeSH
- Check Tag
- Humans MeSH
- Mice MeSH
- Animals MeSH
- Publication type
- Journal Article MeSH
Collagen is the most abundant protein in the animal and human bodies, and it is not exempt from this aging phenomenon. Some age-related changes may appear on collagen sequences, such as increased surface hydrophobicity, the appearance of post-translational modifications, and amino acids racemization. This study has shown that the protein hydrolysis under deuterium conditions is privileged to limit the natural racemization during the hydrolysis. Indeed, under the deuterium condition, the homochirality of recent collagens is preserved whose amino acids are found in their L-form. However, in aging collagen, a natural amino acid racemization was observed. These results confirmed that the % d-amino acids are progressive according to age. The collagen sequence is degraded over time, and a fifth of the sequence information is lost during aging. Post-translational modifications (PTMs) in aging collagens can be a hypothesis to explain the modification of the hydrophobicity of the protein with the decrease of hydrophilic groups and the increase of hydrophobic groups. Finally, the exact positions of d-amino acids and PTMs have been correlated and elucidated.
- MeSH
- Amino Acids * chemistry MeSH
- Chromatography, Liquid MeSH
- Deuterium chemistry MeSH
- Collagen MeSH
- Humans MeSH
- Protein Processing, Post-Translational MeSH
- Proteomics * MeSH
- Aging MeSH
- Tandem Mass Spectrometry methods MeSH
- Animals MeSH
- Check Tag
- Humans MeSH
- Animals MeSH
- Publication type
- Journal Article MeSH
Male germ cells experience a drastic chromatin remodeling through the nucleo-histone to nucleo-protamine (NH-NP) transition necessary for proper sperm functionality. Post-translational modifications (PTMs) of H4 Lys5, such as acetylation (H4K5ac), play a crucial role in epigenetic control of nucleosome disassembly facilitating protamine incorporation into paternal DNA. It has been shown that butyrylation on the same residue (H4K5bu) participates in temporal regulation of NH-NP transition in mice, delaying the bromodomain testis specific protein (BRDT)-dependent nucleosome disassembly and potentially marking retained nucleosomes. However, no information was available so far on this modification in human sperm. Here, we report a dual behavior of H4K5bu and H4K5ac in human normal spermatogenesis, suggesting a specific role of H4K5bu during spermatid elongation, coexisting with H4K5ac although with different starting points. This pattern is stable under different testicular pathologies, suggesting a highly conserved function of these modifications. Despite a drastic decrease of both PTMs in condensed spermatids, they are retained in ejaculated sperm, with 30% of non-colocalizing nucleosome clusters, which could reflect differential paternal genome retention. Whereas no apparent effect of these PTMs was observed associated with sperm quality, their presence in mature sperm could entail a potential role in the zygote.
- MeSH
- Acetylation MeSH
- Chromatin * metabolism MeSH
- Histones metabolism MeSH
- Humans MeSH
- Mice MeSH
- Nucleosomes * metabolism MeSH
- Protein Processing, Post-Translational MeSH
- Protamines metabolism MeSH
- Chromatin Assembly and Disassembly MeSH
- Semen metabolism MeSH
- Spermatids metabolism MeSH
- Spermatogenesis physiology MeSH
- Spermatozoa metabolism MeSH
- Animals MeSH
- Check Tag
- Humans MeSH
- Male MeSH
- Mice MeSH
- Animals MeSH
- Publication type
- Journal Article MeSH
An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.
- MeSH
- DNA metabolism MeSH
- Phosphorylation MeSH
- Genes, p53 * MeSH
- Tumor Suppressor Protein p53 * genetics metabolism MeSH
- DNA Repair MeSH
- DNA Damage MeSH
- Publication type
- Journal Article MeSH
BACKGROUND: Leucine-rich alpha-2-glycoprotein (LRG) has been repeatedly proposed as a potential plasma biomarker for myelodysplastic syndrome (MDS). OBJECTIVE: The goal of our work was to establish the total LRG plasma level and LRG posttranslational modifications (PTMs) as a suitable MDS biomarker. METHODS: The total plasma LRG concentration was determined with ELISA, whilst the LRG-specific PTMs and their locations, were established using mass spectrometry and public mass spectrometry data re-analysis. Homology modelling and sequence analysis were used to establish the potential impact of PTMs on LRG functions via their impact on the LRG structure. RESULTS: While the results showed that the total LRG plasma concentration is not a suitable MDS marker, alterations within two LRG sites correlated with MDS diagnosis (p= 0.0011). Sequence analysis and the homology model suggest the influence of PTMs within the two LRG sites on the function of this protein. CONCLUSIONS: We report the presence of LRG proteoforms that correlate with diagnosis in the plasma of MDS patients. The combination of mass spectrometry, re-analysis of publicly available data, and homology modelling, represents an approach that can be used for any protein to predict clinically relevant protein sites for biomarker research despite the character of the PTMs being unknown.
Persulfidation contributes to a group of redox post-translational modifications (PTMs), which arise exclusively on the sulfhydryl group of cysteine as a result of hydrogen sulfide (H2S) action. Redox-active molecules, including H2S, contribute to sperm development; therefore, redox PTMs represent an extremely important signalling pathway in sperm life. In this path, persulfidation prevents protein damage caused by irreversible cysteine hyperoxidation and thus maintains this signalling pathway. In our study, we detected both H2S and its production by all H2S-releasing enzymes (cystathionine γ-lyase (CTH), cystathionine β-synthase (CBS), and 3-mercaptopyruvate sulfurtransferase (MPST)) in male reproduction, including spermatozoa. We provided evidence that sperm H2S leads to persulfidation of proteins, such as glyceraldehyde-3-phosphate dehydrogenase, tubulin, and anchor protein A-kinase. Overall, this study suggests that persulfidation, as a part of the redox signalling pathway, is tightly regulated by enzymatic H2S production and is required for sperm viability.
- MeSH
- Cystathionine gamma-Lyase metabolism MeSH
- Cysteine metabolism MeSH
- Humans MeSH
- Reproduction MeSH
- Semen metabolism MeSH
- Hydrogen Sulfide * metabolism MeSH
- Check Tag
- Humans MeSH
- Male MeSH
- Publication type
- Journal Article MeSH
- Research Support, Non-U.S. Gov't MeSH
- Research Support, U.S. Gov't, Non-P.H.S. MeSH
Extravasation of monocytes into tissue and to the site of injury is a fundamental immunological process, which requires rapid responses via post translational modifications (PTM) of proteins. Protein arginine methyltransferase 7 (PRMT7) is an epigenetic factor that has the capacity to mono-methylate histones on arginine residues. Here we show that in chronic obstructive pulmonary disease (COPD) patients, PRMT7 expression is elevated in the lung tissue and localized to the macrophages. In mouse models of COPD, lung fibrosis and skin injury, reduced expression of PRMT7 associates with decreased recruitment of monocytes to the site of injury and hence less severe symptoms. Mechanistically, activation of NF-κB/RelA in monocytes induces PRMT7 transcription and consequential mono-methylation of histones at the regulatory elements of RAP1A, which leads to increased transcription of this gene that is responsible for adhesion and migration of monocytes. Persistent monocyte-derived macrophage accumulation leads to ALOX5 over-expression and accumulation of its metabolite LTB4, which triggers expression of ACSL4 a ferroptosis promoting gene in lung epithelial cells. Conclusively, inhibition of arginine mono-methylation might offer targeted intervention in monocyte-driven inflammatory conditions that lead to extensive tissue damage if left untreated.
- MeSH
- Arginine metabolism MeSH
- Pulmonary Disease, Chronic Obstructive * genetics MeSH
- Histones metabolism MeSH
- Intracellular Signaling Peptides and Proteins MeSH
- Humans MeSH
- Monocytes metabolism MeSH
- Mice MeSH
- Protein-Arginine N-Methyltransferases * metabolism MeSH
- Animals MeSH
- Check Tag
- Humans MeSH
- Mice MeSH
- Animals MeSH
- Publication type
- Journal Article MeSH
