The increase in extreme climate events associated with global warming is a great menace to crop productivity nowadays. In addition to abiotic stresses, warmer conditions favor the spread of infectious diseases affecting plant performance. Within this context, beneficial microbes constitute a sustainable alternative for the mitigation of the effects of climate change on plant growth and productivity. Used as biostimulants to improve plant growth, they also increase plant resistance to abiotic and biotic stresses through the generation of a primed status in the plant, leading to a better and faster response to stress. In this review, we have focused on the importance of a balanced redox status for the adequate performance of the plant and revisited the different antioxidant mechanisms supporting the biocontrol effect of beneficial microbes through the adjustment of the levels of reactive oxygen species (ROS). In addition, the different tools for the analysis of antioxidant responses and redox regulation have been evaluated. The importance of redox regulation in the activation of the immune responses through different mechanisms, such as transcriptional regulation, retrograde signaling, and post-translational modification of proteins, emerges as an important research goal for understanding the biocontrol activity of the beneficial microbes.
- Publication type
- Journal Article MeSH
- Review MeSH
Spermatogenesis starts with the onset of puberty within the seminiferous epithelium of the testes. It is a complex process under intricate control of the endocrine system. Physiological regulations by steroid hormones in general and by estrogens in particular are due to their chemical nature prone to be disrupted by exogenous factors acting as endocrine disruptors (EDs). 17α-Ethynylestradiol (EE2) is an environmental pollutant with a confirmed ED activity and a well-known effect on spermatogenesis and chromatin remodeling in haploid germ cells. The aim of our study was to assess possible effects of two doses (2.5ng/ml; 2.5 μg/ml) of EE2 on both histone-to-protamine exchange and epigenetic profiles during spermatogenesis performing a multi/transgenerational study in mice. Our results demonstrated an impaired histone-to-protamine exchange with a significantly higher histone retention in sperm nuclei of exposed animals, when this process was accompanied by the changes of histone post-translational modifications (PTMs) abundancies with a prominent effect on H3K9Ac and partial changes in protamine 1 promoter methylation status. Furthermore, individual changes in molecular phenotypes were partially transmitted to subsequent generations, when no direct trans-generational effect was observed. Finally, the uncovered specific localization of the histone retention in sperm nuclei and their specific PTMs profile after EE2 exposure may indicate an estrogenic effect on sperm motility and early embryonic development via epigenetic mechanisms.
- MeSH
- Endocrine Disruptors pharmacology toxicity MeSH
- Epigenesis, Genetic * drug effects MeSH
- Ethinyl Estradiol * pharmacology MeSH
- Histones * metabolism MeSH
- Mice MeSH
- Protein Processing, Post-Translational drug effects MeSH
- Protamines * metabolism genetics MeSH
- Spermatogenesis * drug effects genetics MeSH
- Spermatozoa drug effects metabolism MeSH
- Testis * drug effects metabolism MeSH
- Animals MeSH
- Check Tag
- Male MeSH
- Mice MeSH
- Female MeSH
- Animals MeSH
- Publication type
- Journal Article MeSH
OBJECTIVE: Redox signaling mediated by reversible oxidative cysteine thiol modifications is crucial for driving cellular adaptation to dynamic environmental changes, maintaining homeostasis, and ensuring proper function. This is particularly critical in pancreatic β-cells, which are highly metabolically active and play a specialized role in whole organism glucose homeostasis. Glucose stimulation in β-cells triggers signals leading to insulin secretion, including changes in ATP/ADP ratio and intracellular calcium levels. Additionally, lipid metabolism and reactive oxygen species (ROS) signaling are essential for β-cell function and health. METHODS: We employed IodoTMT isobaric labeling combined with tandem mass spectrometry to elucidate redox signaling pathways in pancreatic β-cells. RESULTS: Glucose stimulation significantly increases ROS levels in β-cells, leading to targeted reversible oxidation of proteins involved in key metabolic pathways such as glycolysis, the tricarboxylic acid (TCA) cycle, pyruvate metabolism, oxidative phosphorylation, protein processing in the endoplasmic reticulum (ER), and insulin secretion. Furthermore, the glucose-induced increase in reversible cysteine oxidation correlates with the presence of other post-translational modifications, including acetylation and phosphorylation. CONCLUSIONS: Proper functioning of pancreatic β-cell metabolism relies on fine-tuned regulation, achieved through a sophisticated system of diverse post-translational modifications that modulate protein functions. Our findings demonstrate that glucose induces the production of ROS in pancreatic β-cells, leading to targeted reversible oxidative modifications of proteins. Furthermore, protein activity is modulated by acetylation and phosphorylation, highlighting the complexity of the regulatory mechanisms in β-cell function.
- MeSH
- Insulin-Secreting Cells * metabolism drug effects MeSH
- Adaptation, Physiological physiology MeSH
- Glucose * metabolism MeSH
- Humans MeSH
- Mice MeSH
- Oxidation-Reduction * MeSH
- Protein Processing, Post-Translational MeSH
- Reactive Oxygen Species * metabolism MeSH
- Insulin Secretion drug effects physiology MeSH
- Signal Transduction * physiology MeSH
- Animals MeSH
- Check Tag
- Humans MeSH
- Mice MeSH
- Animals MeSH
- Publication type
- Journal Article MeSH
BACKGROUND: Obesity is a major health burden. Preadipocytes proliferate and differentiate in mature adipocytes in the adipogenic process, which could be a potential therapeutic approach for obesity. Deficiency of SIRT6, a stress-responsive protein deacetylase and mono-ADP ribosyltransferase enzyme, blocks adipogenesis. Mutants of SIRT6 (N308K/A313S) were recently linked to the in the long lifespan Ashkenazi Jews. In this study, we aimed to clarify how these new centenarian-associated SIRT6 genetic variants affect adipogenesis at the transcriptional and epigenetic level. METHODS: We analyzed the role of SIRT6 wild-type (WT) or SIRT6 centenarian-associated mutant (N308K/A313S) overexpression in adipogenesis, by creating stably transduced preadipocyte cell lines using lentivirus on the 3T3-L1 model. Histone post-translational modifications (PTM: acetylation, methylation) and transcriptomic changes were analyzed by mass spectrometry (LC-MS/MS) and RNA-Seq, respectively, in 3T3-L1 adipocytes. In addition, the adipogenic process and related signaling pathways were investigated by bioinformatics and biochemical approaches. RESULTS: Overexpression of centenarian-associated SIRT6 mutant increased adipogenic differentiation to a similar extent compared to the WT form. However, it triggered distinct histone PTM profiles in mature adipocytes, with significantly higher acetylation levels, and activated divergent transcriptional programs, including those dependent on signaling related to the sympathetic innervation and to PI3K pathway. 3T3-L1 mature adipocytes overexpressing SIRT6 N308K/A313S displayed increased insulin sensitivity in a neuropeptide Y (NPY)-dependent manner. CONCLUSIONS: SIRT6 N308K/A313S overexpression in mature adipocytes ameliorated glucose sensitivity and impacted sympathetic innervation signaling. These findings highlight the importance of targeting SIRT6 enzymatic activities to regulate the co-morbidities associated with obesity.
- MeSH
- Adipogenesis * genetics MeSH
- 3T3-L1 Cells * MeSH
- Epigenesis, Genetic * genetics MeSH
- Histones metabolism genetics MeSH
- Humans MeSH
- Mutation MeSH
- Mice MeSH
- Obesity genetics metabolism MeSH
- Protein Processing, Post-Translational genetics MeSH
- Sirtuins * genetics metabolism MeSH
- Adipocytes * metabolism MeSH
- Animals MeSH
- Check Tag
- Humans MeSH
- Mice MeSH
- Animals MeSH
- Publication type
- Journal Article MeSH
The RAS pathway is among the most frequently activated signaling nodes in cancer. However, the mechanisms that alter RAS activity in human pathologies are not entirely understood. The most prevalent post-translational modification within the GTPase core domain of NRAS and KRAS is ubiquitination at lysine 128 (K128), which is significantly decreased in cancer samples compared to normal tissue. Here, we found that K128 ubiquitination creates an additional binding interface for RAS GTPase-activating proteins (GAPs), NF1 and RASA1, thus increasing RAS binding to GAP proteins and promoting GAP-mediated GTP hydrolysis. Stimulation of cultured cancer cells with growth factors or cytokines transiently induces K128 ubiquitination and restricts the extent of wild-type RAS activation in a GAP-dependent manner. In KRAS mutant cells, K128 ubiquitination limits tumor growth by restricting RAL/ TBK1 signaling and negatively regulating the autocrine circuit induced by mutant KRAS. Reduction of K128 ubiquitination activates both wild-type and mutant RAS signaling and elicits a senescence-associated secretory phenotype, promoting RAS-driven pancreatic tumorigenesis.
- MeSH
- GTP Phosphohydrolases metabolism genetics MeSH
- Humans MeSH
- Lysine metabolism MeSH
- Membrane Proteins metabolism genetics MeSH
- Mice MeSH
- Cell Line, Tumor MeSH
- Neurofibromin 1 MeSH
- p120 GTPase Activating Protein metabolism genetics MeSH
- Protein Serine-Threonine Kinases metabolism genetics MeSH
- Proto-Oncogene Proteins p21(ras) * metabolism genetics MeSH
- ras Proteins metabolism genetics MeSH
- Signal Transduction MeSH
- Ubiquitination * MeSH
- Protein Binding * MeSH
- Animals MeSH
- Check Tag
- Humans MeSH
- Mice MeSH
- Animals MeSH
- Publication type
- Journal Article MeSH
Gene therapy is a focus of interest in both human and veterinary medicine, especially in recent years due to the potential applications of CRISPR/Cas9 technology. Another relatively new approach is that of epigenetic therapy, which involves an intervention based on epigenetic marks, including DNA methylation, histone post-translational modifications, and post-transcription modifications of distinct RNAs. The epigenome results from enzymatic reactions, which regulate gene expression without altering DNA sequences. In contrast to conventional CRISP/Cas9 techniques, the recently established methodology of epigenetic editing mediated by the CRISPR/dCas9 system is designed to target specific genes without causing DNA breaks. Both natural epigenetic processes and epigenetic editing regulate gene expression and thereby contribute to maintaining the balance between physiological functions and pathophysiological states. From this perspective, knowledge of specific epigenetic marks has immense potential in both human and veterinary medicine. For instance, the use of epigenetic drugs (chemical compounds with therapeutic potential affecting the epigenome) seems to be promising for the treatment of cancer, metabolic, and infectious diseases. Also, there is evidence that an epigenetic diet (nutrition-like factors affecting epigenome) should be considered as part of a healthy lifestyle and could contribute to the prevention of pathophysiological processes. In summary, epigenetic-based approaches in human and veterinary medicine have increasing significance in targeting aberrant gene expression associated with various diseases. In this case, CRISPR/dCas9, epigenetic targeting, and some epigenetic nutrition factors could contribute to reversing an abnormal epigenetic landscape to a healthy physiological state.
- Publication type
- Journal Article MeSH
- Review MeSH
B-cell receptor (BCR) is a B cell hallmark surface complex regulating multiple cellular processes in normal as well as malignant B cells. Igα (CD79a)/Igβ (CD79b) are essential components of BCR that are indispensable for its functionality, signal initiation, and signal transduction. CD79a/CD79b-mediated BCR signaling is required for the survival of normal as well as malignant B cells via a wide signaling network. Recent studies identified the great complexity of this signaling network and revealed the emerging role of CD79a/CD79b in signal integration. In this review, we have focused on functional features of CD79a/CD79b, summarized signaling consequences of CD79a/CD79b post-translational modifications, and highlighted specifics of CD79a/CD79b interactions within BCR and related signaling cascades. We have reviewed the complex role of CD79a/CD79b in multiple aspects of normal B cell biology and how is the normal BCR signaling affected by lymphoid neoplasms associated CD79A/CD79B mutations. We have also summarized important unresolved questions and highlighted issues that remain to be explored for better understanding of CD79a/CD79b-mediated signal transduction and the eventual identification of additional therapeutically targetable BCR signaling vulnerabilities.
- MeSH
- Cell Membrane MeSH
- Cognition MeSH
- Mutation MeSH
- Receptors, Antigen, B-Cell * genetics MeSH
- Signal Transduction * MeSH
- Publication type
- Journal Article MeSH
- Review MeSH
Pronounced genetic variation in four -- classes of immune system proteins 99 -- Programmed and random post specificity -- Genetic regulation during RNA -- processing: RNA splicing and RNA -- editing -- Translational regulation by trans- -- acting regulatory proteins . -- Post-transcriptional gene silencing -- by microRNAs RNAs -- sequester miRNA -- 139 -- 140 -- 141 -- I4l -- 142 -- 143 -- 144 -- 147 -- 6.2 CHROMATIN MODIFICATION in some -- emerging treatments for -- genetic disorders 485 -- The ethics of germline gene -- modification
2nd ed. 534 s. : il.
"Genetics and Genomics in Medicine is a new textbook written for undergraduate and graduate students, as well as medical researchers, which explains the science behind the uses of genetics and genomics in medicine today. It is not just about rare inherited and chromosomal disorders, but how genetics affects the whole spectrum of human health and disease. DNA technologies are explained, with emphasis on the modern techniques that have revolutionized the use of genetic information in medicine and are indicating the role of genetics in common complex diseases. The detailed, integrative coverage of genetic approaches to treatment and prevention includes pharmacogenomics and the prospects for personalized medicine. Cancers are essentially genetic diseases and are given a dedicated chapter that includes new insights from cancer genome sequencing. Clinical disorders are covered throughout and there are extensive end-of-chapter questions and problems"--Provided by publisher.
An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.
- MeSH
- DNA metabolism MeSH
- Phosphorylation MeSH
- Genes, p53 * MeSH
- Tumor Suppressor Protein p53 * genetics metabolism MeSH
- DNA Repair MeSH
- DNA Damage MeSH
- Publication type
- Journal Article MeSH
The etiopathogenesis of mental disorders is not fully understood and accumulating evidence support that clinical symptomatology cannot be assigned to a single gene mutation, but it involves several genetic factors. More specifically, a tight association between genes and environmental risk factors, which could be mediated by epigenetic mechanisms, may play a role in the development of mental disorders. Several data suggest that epigenetic modifications such as DNA methylation, post-translational histone modification and interference of microRNA (miRNA) or long non-coding RNA (lncRNA) may modify the severity of the disease and the outcome of the therapy. Indeed, the study of these mechanisms may help to identify patients particularly vulnerable to mental disorders and may have potential utility as biomarkers to facilitate diagnosis and treatment of psychiatric disorders. This article summarizes the most relevant preclinical and human data showing how epigenetic modifications can be central to the therapeutic efficacy of antidepressant and/or antipsychotic agents, as possible predictor of drugs response.
